Incidental Mutation 'R6641:Aadac'
ID525775
Institutional Source Beutler Lab
Gene Symbol Aadac
Ensembl Gene ENSMUSG00000027761
Gene Namearylacetamide deacetylase
SynonymsAada, 5033417E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6641 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location60025717-60040160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60039732 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 284 (S284P)
Ref Sequence ENSEMBL: ENSMUSP00000029325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029325]
Predicted Effect probably damaging
Transcript: ENSMUST00000029325
AA Change: S284P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029325
Gene: ENSMUSG00000027761
AA Change: S284P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Abhydrolase_3 106 277 3.8e-41 PFAM
Pfam:Abhydrolase_3 279 376 1.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194896
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microsomal arylacetamide deacetylase competes against the activity of cytosolic arylamine N-acetyltransferase, which catalyzes one of the initial biotransformation pathways for arylamine and heterocyclic amine carcinogens [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,245 I193V possibly damaging Het
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Gm3404 C A 5: 146,527,708 A173D probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Klk10 G T 7: 43,784,900 D239Y possibly damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc22a15 G A 3: 101,875,706 A216V possibly damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Slc7a13 G A 4: 19,839,534 G379E probably damaging Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Spef2 A T 15: 9,625,973 M1169K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in Aadac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Aadac APN 3 60037342 splice site probably benign
IGL01518:Aadac APN 3 60035899 missense probably damaging 1.00
IGL02480:Aadac APN 3 60039487 missense probably benign 0.12
IGL03164:Aadac APN 3 60039649 missense probably damaging 1.00
IGL03309:Aadac APN 3 60039882 missense possibly damaging 0.65
R0383:Aadac UTSW 3 60035947 missense possibly damaging 0.80
R0918:Aadac UTSW 3 60039532 missense probably damaging 1.00
R1381:Aadac UTSW 3 60039930 missense probably damaging 1.00
R1848:Aadac UTSW 3 60039697 missense probably damaging 1.00
R1964:Aadac UTSW 3 60037338 critical splice donor site probably null
R2103:Aadac UTSW 3 60039814 missense probably damaging 1.00
R2125:Aadac UTSW 3 60039645 missense possibly damaging 0.67
R2126:Aadac UTSW 3 60039645 missense possibly damaging 0.67
R2265:Aadac UTSW 3 60037316 missense probably damaging 1.00
R2266:Aadac UTSW 3 60037316 missense probably damaging 1.00
R2267:Aadac UTSW 3 60037316 missense probably damaging 1.00
R4200:Aadac UTSW 3 60039534 missense probably damaging 1.00
R4229:Aadac UTSW 3 60031813 missense possibly damaging 0.89
R4361:Aadac UTSW 3 60039761 missense probably benign
R4750:Aadac UTSW 3 60035817 missense probably benign
R5367:Aadac UTSW 3 60039636 missense probably damaging 1.00
R5383:Aadac UTSW 3 60036075 intron probably benign
R5536:Aadac UTSW 3 60039563 missense probably benign 0.12
R5907:Aadac UTSW 3 60039827 missense probably damaging 1.00
R6805:Aadac UTSW 3 60037336 missense probably benign 0.30
R6979:Aadac UTSW 3 60040003 missense probably benign 0.01
R7224:Aadac UTSW 3 60035854 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGGCTCTTGATACGAATGTACC -3'
(R):5'- GCCGCTTGACATACATGAGTC -3'

Sequencing Primer
(F):5'- GGCTCTTGATACGAATGTACCATCAC -3'
(R):5'- CTCTTAGGACATCATACTGGCAAGTG -3'
Posted On2018-06-22