Incidental Mutation 'R6641:Slc22a15'
ID525778
Institutional Source Beutler Lab
Gene Symbol Slc22a15
Ensembl Gene ENSMUSG00000033147
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 15
SynonymsA530052I06Rik, 2610034P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6641 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location101855776-101924453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101875706 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 216 (A216V)
Ref Sequence ENSEMBL: ENSMUSP00000139518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106928] [ENSMUST00000183255] [ENSMUST00000190824]
Predicted Effect probably benign
Transcript: ENSMUST00000106928
AA Change: A371V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102541
Gene: ENSMUSG00000033147
AA Change: A371V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 58 495 6.9e-29 PFAM
Pfam:MFS_1 69 450 3.4e-24 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183098
Predicted Effect probably benign
Transcript: ENSMUST00000183255
SMART Domains Protein: ENSMUSP00000138357
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 56 244 5.2e-13 PFAM
Pfam:MFS_1 69 244 7.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183293
Predicted Effect possibly damaging
Transcript: ENSMUST00000190824
AA Change: A216V

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139518
Gene: ENSMUSG00000033147
AA Change: A216V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Sugar_tr 88 341 3.3e-5 PFAM
low complexity region 369 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Organic ion transporters, such as SLC22A15, transport various medically and physiologically important compounds, including pharmaceuticals, toxins, hormones, neurotransmitters, and cellular metabolites. These transporters are also referred to as amphiphilic solute facilitators (ASFs).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,245 I193V possibly damaging Het
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Aadac T C 3: 60,039,732 S284P probably damaging Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Gm3404 C A 5: 146,527,708 A173D probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Klk10 G T 7: 43,784,900 D239Y possibly damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Slc7a13 G A 4: 19,839,534 G379E probably damaging Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Spef2 A T 15: 9,625,973 M1169K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in Slc22a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Slc22a15 APN 3 101860820 missense probably benign 0.00
IGL01120:Slc22a15 APN 3 101897166 missense probably damaging 1.00
IGL01345:Slc22a15 APN 3 101880176 missense probably benign 0.00
IGL01871:Slc22a15 APN 3 101860794 splice site probably benign
IGL01880:Slc22a15 APN 3 101860848 missense probably benign 0.32
R0310:Slc22a15 UTSW 3 101860511 missense probably benign 0.12
R1758:Slc22a15 UTSW 3 101860453 nonsense probably null
R1937:Slc22a15 UTSW 3 101880189 critical splice acceptor site probably null
R3804:Slc22a15 UTSW 3 101897274 missense probably damaging 1.00
R4830:Slc22a15 UTSW 3 101875603 intron probably benign
R5564:Slc22a15 UTSW 3 101864589 missense probably benign 0.34
R5684:Slc22a15 UTSW 3 101862955 missense probably damaging 1.00
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6114:Slc22a15 UTSW 3 101860852 nonsense probably null
R6481:Slc22a15 UTSW 3 101883583 missense possibly damaging 0.88
R6945:Slc22a15 UTSW 3 101924114 missense probably damaging 0.99
R7354:Slc22a15 UTSW 3 101864581 missense probably benign 0.09
R7373:Slc22a15 UTSW 3 101877897 missense possibly damaging 0.78
R7431:Slc22a15 UTSW 3 101897940 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TATGCAATCACAGGAATGAAGC -3'
(R):5'- TCCTGTGTACATGATATGATCCTG -3'

Sequencing Primer
(F):5'- AGCGCGGCATATGGTAATCC -3'
(R):5'- CTTTGGAGAGACATGTGACTT -3'
Posted On2018-06-22