Incidental Mutation 'R6641:Slc7a13'
ID525784
Institutional Source Beutler Lab
Gene Symbol Slc7a13
Ensembl Gene ENSMUSG00000041052
Gene Namesolute carrier family 7, (cationic amino acid transporter, y+ system) member 13
SynonymsAGT1, XAT2, AGT-1, 0610009O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6641 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location19818725-19842218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19839534 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 379 (G379E)
Ref Sequence ENSEMBL: ENSMUSP00000036228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035890]
Predicted Effect probably damaging
Transcript: ENSMUST00000035890
AA Change: G379E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036228
Gene: ENSMUSG00000041052
AA Change: G379E

DomainStartEndE-ValueType
Pfam:AA_permease_2 17 440 3.3e-44 PFAM
Pfam:AA_permease 21 454 3.7e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,245 I193V possibly damaging Het
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Aadac T C 3: 60,039,732 S284P probably damaging Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Gm3404 C A 5: 146,527,708 A173D probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Klk10 G T 7: 43,784,900 D239Y possibly damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc22a15 G A 3: 101,875,706 A216V possibly damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Spef2 A T 15: 9,625,973 M1169K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in Slc7a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Slc7a13 APN 4 19839527 missense probably benign 0.00
IGL02491:Slc7a13 APN 4 19841404 missense probably damaging 0.98
IGL02541:Slc7a13 APN 4 19839212 splice site probably benign
IGL02814:Slc7a13 APN 4 19839387 missense probably benign
R0145:Slc7a13 UTSW 4 19818782 start gained probably benign
R0305:Slc7a13 UTSW 4 19839401 missense probably benign 0.12
R0468:Slc7a13 UTSW 4 19841500 missense probably benign 0.04
R0522:Slc7a13 UTSW 4 19824010 missense probably benign 0.02
R0848:Slc7a13 UTSW 4 19818866 missense probably benign 0.00
R1240:Slc7a13 UTSW 4 19819212 missense probably damaging 1.00
R1623:Slc7a13 UTSW 4 19824031 missense possibly damaging 0.84
R1830:Slc7a13 UTSW 4 19819046 missense probably benign 0.33
R1903:Slc7a13 UTSW 4 19839254 missense probably benign 0.01
R1952:Slc7a13 UTSW 4 19841578 missense probably benign
R2229:Slc7a13 UTSW 4 19839399 missense probably benign 0.43
R2887:Slc7a13 UTSW 4 19819052 missense possibly damaging 0.69
R4175:Slc7a13 UTSW 4 19819492 missense probably null 0.99
R4233:Slc7a13 UTSW 4 19819070 missense probably damaging 0.97
R4764:Slc7a13 UTSW 4 19819390 missense probably benign 0.08
R4941:Slc7a13 UTSW 4 19841467 missense probably damaging 1.00
R5355:Slc7a13 UTSW 4 19839267 missense probably benign 0.43
R6221:Slc7a13 UTSW 4 19839305 missense probably benign 0.00
R7237:Slc7a13 UTSW 4 19839364 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGAGAATGGCCAGCTGC -3'
(R):5'- AGAGAGATGATAATCTGCCTAAGC -3'

Sequencing Primer
(F):5'- CCAGCTGCCTTTGTTGTTTTG -3'
(R):5'- GGCCTCATTTATTTCTGTACCAAGAG -3'
Posted On2018-06-22