Incidental Mutation 'R6641:Gm3404'
ID525795
Institutional Source Beutler Lab
Gene Symbol Gm3404
Ensembl Gene ENSMUSG00000079091
Gene Namepredicted gene 3404
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6641 (G1)
Quality Score148.008
Status Not validated
Chromosome5
Chromosomal Location146525801-146528553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146527708 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 173 (A173D)
Ref Sequence ENSEMBL: ENSMUSP00000106226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110596]
Predicted Effect probably damaging
Transcript: ENSMUST00000110596
AA Change: A173D

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106226
Gene: ENSMUSG00000079091
AA Change: A173D

DomainStartEndE-ValueType
RasGEFN 66 181 2.8e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,245 I193V possibly damaging Het
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Aadac T C 3: 60,039,732 S284P probably damaging Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Klk10 G T 7: 43,784,900 D239Y possibly damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc22a15 G A 3: 101,875,706 A216V possibly damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Slc7a13 G A 4: 19,839,534 G379E probably damaging Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Spef2 A T 15: 9,625,973 M1169K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in Gm3404
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Gm3404 APN 5 146528285 missense probably damaging 0.98
IGL01611:Gm3404 APN 5 146528347 missense possibly damaging 0.46
IGL02721:Gm3404 APN 5 146526928 nonsense probably null
IGL03134:Gm3404 UTSW 5 146526896 missense probably benign
R1758:Gm3404 UTSW 5 146526226 missense probably benign 0.02
R6324:Gm3404 UTSW 5 146528107 missense possibly damaging 0.79
R6671:Gm3404 UTSW 5 146527677 missense probably benign 0.05
R7042:Gm3404 UTSW 5 146526159 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTTCTGACTCAACTTCC -3'
(R):5'- AGGCCTTTTCATGACAGAAGATC -3'

Sequencing Primer
(F):5'- TGACTCAACTTCCCTCCAAC -3'
(R):5'- TTTTCATGACAGAAGATCCCCAGTC -3'
Posted On2018-06-22