Incidental Mutation 'R6609:Cdc7'
ID525816
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Namecell division cycle 7 (S. cerevisiae)
SynonymsCdc7, muCdc7, Cdc7l1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6609 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location106964322-106984432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106973058 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 182 (R182H)
Ref Sequence ENSEMBL: ENSMUSP00000113385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
Predicted Effect probably benign
Transcript: ENSMUST00000031221
AA Change: R182H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283
AA Change: R182H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076467
AA Change: R182H

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283
AA Change: R182H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117196
AA Change: R182H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283
AA Change: R182H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118261
AA Change: R182H

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283
AA Change: R182H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123546
Predicted Effect probably benign
Transcript: ENSMUST00000129938
AA Change: R182H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283
AA Change: R182H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199223
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,928,762 V421I probably damaging Het
Bpifb3 T A 2: 153,920,648 probably null Het
C1rl T C 6: 124,508,624 V318A probably benign Het
Cacna1b C T 2: 24,653,049 V1264M probably damaging Het
Cacna1s A G 1: 136,113,391 D1551G probably benign Het
Cdc42bpa T G 1: 180,101,274 probably null Het
Cyth1 A T 11: 118,170,860 L309Q probably damaging Het
Dnah6 G A 6: 73,053,695 T3378I possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Get4 A G 5: 139,269,065 probably benign Het
Gm136 T A 4: 34,746,526 M162L probably benign Het
Grik5 G T 7: 25,015,526 S681* probably null Het
Hsf5 C T 11: 87,635,953 P484S probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kl A T 5: 150,988,962 K725N probably benign Het
Lama3 G A 18: 12,513,678 V144M probably damaging Het
Lrrc14 T C 15: 76,714,253 V363A probably benign Het
Mettl15 T C 2: 109,137,342 R200G probably null Het
Mki67 T C 7: 135,699,829 T1159A possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ndufb5 C G 3: 32,741,683 T8R probably benign Het
Olfr1313 T C 2: 112,072,164 M140V probably benign Het
Olfr522 C A 7: 140,162,563 R129L probably benign Het
Pde1a T A 2: 79,906,140 D15V probably damaging Het
Plcg2 G A 8: 117,568,170 G191S probably benign Het
Ptprq T C 10: 107,572,968 T1895A probably damaging Het
Pxdn T C 12: 30,002,941 V1039A probably benign Het
Slc26a5 T C 5: 21,819,719 I456V possibly damaging Het
Smco4 C T 9: 15,544,735 A39V probably damaging Het
Tmem102 T A 11: 69,805,114 L40F probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zfp985 A T 4: 147,583,121 M149L probably benign Het
Zfp985 T C 4: 147,583,667 F331L probably damaging Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 106968860 missense probably benign
IGL01671:Cdc7 APN 5 106983245 missense probably damaging 1.00
IGL03373:Cdc7 APN 5 106972919 splice site probably benign
R0179:Cdc7 UTSW 5 106965039 missense probably benign 0.02
R0563:Cdc7 UTSW 5 106972910 splice site probably benign
R1621:Cdc7 UTSW 5 106965054 missense probably benign
R1970:Cdc7 UTSW 5 106973074 splice site probably benign
R2044:Cdc7 UTSW 5 106983132 missense probably benign
R2993:Cdc7 UTSW 5 106973898 missense probably benign
R3110:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R3112:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R4700:Cdc7 UTSW 5 106973841 missense probably benign 0.00
R5396:Cdc7 UTSW 5 106969297 splice site probably null
R6217:Cdc7 UTSW 5 106972794 missense probably damaging 1.00
R6258:Cdc7 UTSW 5 106969227 missense probably damaging 1.00
R6285:Cdc7 UTSW 5 106983059 missense probably benign 0.00
V8831:Cdc7 UTSW 5 106968910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCGTATCTGGAACATGAGTC -3'
(R):5'- CCGTCTAAGTGTGCATCTCAC -3'

Sequencing Primer
(F):5'- ATCTGGAACATGAGTCCTTTTTG -3'
(R):5'- CGATGCCATCGCGCTAC -3'
Posted On2018-06-22