Incidental Mutation 'R6610:Etl4'
ID525864
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Nameenhancer trap locus 4
Synonyms6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location19909780-20810713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20713369 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 256 (R256K)
Ref Sequence ENSEMBL: ENSMUSP00000110261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627]
Predicted Effect probably damaging
Transcript: ENSMUST00000045555
AA Change: R256K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: R256K

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066509
AA Change: R256K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: R256K

DomainStartEndE-ValueType
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114604
AA Change: R256K

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: R256K

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114610
AA Change: R176K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617
AA Change: R176K

DomainStartEndE-ValueType
Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114614
AA Change: R256K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: R256K

DomainStartEndE-ValueType
Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114627
AA Change: R307K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: R307K

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146613
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20781883 missense probably damaging 1.00
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6151:Etl4 UTSW 2 20713360 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6248:Etl4 UTSW 2 20809089 missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 synonymous probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
R7305:Etl4 UTSW 2 20709557 missense probably damaging 1.00
R7389:Etl4 UTSW 2 20785093 nonsense probably null
R7396:Etl4 UTSW 2 20798638 missense possibly damaging 0.62
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCAAGAATAACATGTTCG -3'
(R):5'- AGCAGCATGAACCTGGGAAC -3'

Sequencing Primer
(F):5'- CTGCAAGAATAACATGTTCGCTAGG -3'
(R):5'- AACCATGGTCGTCAGGTATG -3'
Posted On2018-06-22