Mutagenetix > Incidental Mutation

Incidental Mutation 'R6610:Cntnap2'

525883

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

Caspr2, 5430425M22Rik

MMRRC Submission

044733-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6610 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45036995-47278330 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 45992191 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 373 (T373S)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: T373S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: T373S

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Meta Mutation Damage Score

0.0699

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AB124611	A	T	9: 21,437,561 (GRCm39)	M1L	probably benign	Het
Adam26b	T	C	8: 43,974,190 (GRCm39)	K271E	probably damaging	Het
Ankrd44	A	G	1: 54,694,246 (GRCm39)	I914T	probably benign	Het
Atp12a	A	G	14: 56,612,013 (GRCm39)	R396G	probably damaging	Het
C2cd3	A	G	7: 100,104,505 (GRCm39)	K2173E	probably benign	Het
Cbx2	A	G	11: 118,915,036 (GRCm39)	D51G	probably damaging	Het
Ccdc33	T	A	9: 57,976,419 (GRCm39)	T532S	possibly damaging	Het
Ccnt1	T	C	15: 98,462,982 (GRCm39)	I63M	probably damaging	Het
Cdc20b	C	T	13: 113,200,796 (GRCm39)	T172I	probably benign	Het
Cep20	TTGTG	TTG	16: 14,118,009 (GRCm39)		probably null	Het
Ces2f	T	G	8: 105,676,738 (GRCm39)		probably null	Het
Cfh	A	T	1: 140,029,486 (GRCm39)	C597*	probably null	Het
Cyb5r4	T	G	9: 86,941,470 (GRCm39)	C64G	probably benign	Het
Cyp2c23	A	G	19: 43,995,520 (GRCm39)	F416L	probably damaging	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Eif4e1b	A	G	13: 54,932,128 (GRCm39)		probably benign	Het
Elp1	A	G	4: 56,758,236 (GRCm39)	V1227A	probably benign	Het
Etl4	G	A	2: 20,718,180 (GRCm39)	R256K	probably damaging	Het
Fhad1	A	G	4: 141,643,707 (GRCm39)	L1054P	possibly damaging	Het
Grik1	A	G	16: 87,831,200 (GRCm39)	I190T	probably damaging	Het
Gsdmc2	T	C	15: 63,696,857 (GRCm39)	N438S	probably benign	Het
Igkv15-103	A	T	6: 68,414,617 (GRCm39)	R19*	probably null	Het
Kcnc2	G	C	10: 112,107,761 (GRCm39)	G51R	probably benign	Het
Lhcgr	A	T	17: 89,077,307 (GRCm39)	I93K	possibly damaging	Het
Muc6	G	C	7: 141,226,700 (GRCm39)		probably benign	Het
Mymk	G	T	2: 26,957,405 (GRCm39)	S29R	possibly damaging	Het
Nab2	A	T	10: 127,500,207 (GRCm39)	I295N	probably damaging	Het
Neu2	A	T	1: 87,524,407 (GRCm39)	T131S	probably benign	Het
Pdcd7	T	A	9: 65,261,965 (GRCm39)	M129K	possibly damaging	Het
Ptar1	A	G	19: 23,695,208 (GRCm39)	H225R	probably benign	Het
Pygb	T	A	2: 150,665,886 (GRCm39)		probably null	Het
Rpap3	T	C	15: 97,586,049 (GRCm39)	D314G	probably benign	Het
Scara3	A	G	14: 66,168,670 (GRCm39)	S316P	probably damaging	Het
Sec24a	C	T	11: 51,587,483 (GRCm39)	V1051I	probably benign	Het
Setdb1	G	T	3: 95,235,888 (GRCm39)	A841D	probably damaging	Het
Stk32b	G	A	5: 37,606,022 (GRCm39)	T407I	probably benign	Het
Tcte2	G	A	17: 13,948,250 (GRCm39)	Q10*	probably null	Het
Tgm2	C	A	2: 157,985,020 (GRCm39)	E29*	probably null	Het
Trim32	G	A	4: 65,533,308 (GRCm39)	V622M	probably damaging	Het
Ttn	G	A	2: 76,579,673 (GRCm39)	T23740M	probably damaging	Het
Tyk2	G	T	9: 21,019,312 (GRCm39)	Q1014K	probably benign	Het
Vmn1r123	A	G	7: 20,896,515 (GRCm39)	N136D	probably benign	Het
Vmn2r31	A	T	7: 7,387,588 (GRCm39)	V661E	probably damaging	Het
Vmn2r85	A	T	10: 130,261,838 (GRCm39)	F166L	probably damaging	Het
Zfp426	T	C	9: 20,384,389 (GRCm39)	K98R	probably damaging	Het
Zfp534	C	T	4: 147,758,947 (GRCm39)	R574K	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	45,992,197 (GRCm39)	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46,965,721 (GRCm39)	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47,169,972 (GRCm39)	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46,461,006 (GRCm39)	missense	probably benign
IGL00857:Cntnap2	APN	6	47,026,358 (GRCm39)	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	45,992,399 (GRCm39)	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47,169,947 (GRCm39)	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47,248,305 (GRCm39)	nonsense	probably null
IGL01859:Cntnap2	APN	6	46,965,655 (GRCm39)	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46,211,137 (GRCm39)	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	46,998,588 (GRCm39)	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46,211,254 (GRCm39)	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	46,998,670 (GRCm39)	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46,147,179 (GRCm39)	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46,507,105 (GRCm39)	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45,969,007 (GRCm39)	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46,460,917 (GRCm39)	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45,037,326 (GRCm39)	splice site	probably null
R0352:Cntnap2	UTSW	6	45,969,018 (GRCm39)	splice site	probably null
R0389:Cntnap2	UTSW	6	45,986,571 (GRCm39)	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45,692,750 (GRCm39)	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46,506,839 (GRCm39)	nonsense	probably null
R0611:Cntnap2	UTSW	6	47,072,483 (GRCm39)	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46,965,694 (GRCm39)	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47,273,642 (GRCm39)	splice site	probably benign
R0976:Cntnap2	UTSW	6	47,248,164 (GRCm39)	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1195:Cntnap2	UTSW	6	46,460,902 (GRCm39)	missense	probably benign
R1387:Cntnap2	UTSW	6	47,084,848 (GRCm39)	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46,507,613 (GRCm39)	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	45,992,264 (GRCm39)	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47,084,826 (GRCm39)	nonsense	probably null
R1757:Cntnap2	UTSW	6	46,736,763 (GRCm39)	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46,965,609 (GRCm39)	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46,507,567 (GRCm39)	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47,275,522 (GRCm39)	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47,275,379 (GRCm39)	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	45,992,200 (GRCm39)	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45,968,837 (GRCm39)	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4030:Cntnap2	UTSW	6	46,833,062 (GRCm39)	missense	probably benign
R4237:Cntnap2	UTSW	6	46,507,324 (GRCm39)	intron	probably benign
R4445:Cntnap2	UTSW	6	46,736,785 (GRCm39)	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45,037,251 (GRCm39)	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4918:Cntnap2	UTSW	6	46,506,969 (GRCm39)	intron	probably benign
R4999:Cntnap2	UTSW	6	45,897,768 (GRCm39)	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47,084,903 (GRCm39)	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45,897,860 (GRCm39)	nonsense	probably null
R5748:Cntnap2	UTSW	6	45,692,818 (GRCm39)	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46,506,749 (GRCm39)	intron	probably benign
R6118:Cntnap2	UTSW	6	47,170,011 (GRCm39)	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46,736,742 (GRCm39)	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47,248,232 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45,037,046 (GRCm39)	splice site	probably null
R6385:Cntnap2	UTSW	6	46,833,114 (GRCm39)	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46,736,694 (GRCm39)	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46,147,206 (GRCm39)	missense	probably benign	0.25
R6761:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46,965,580 (GRCm39)	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47,248,205 (GRCm39)	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46,460,963 (GRCm39)	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47,072,621 (GRCm39)	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46,324,079 (GRCm39)	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47,072,627 (GRCm39)	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47,026,307 (GRCm39)	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46,736,707 (GRCm39)	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45,968,975 (GRCm39)	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47,026,156 (GRCm39)	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	45,978,161 (GRCm39)	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46,833,076 (GRCm39)	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46,460,983 (GRCm39)	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46,461,139 (GRCm39)	intron	probably benign
R9209:Cntnap2	UTSW	6	47,026,183 (GRCm39)	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	45,978,112 (GRCm39)	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	45,978,281 (GRCm39)	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	45,978,244 (GRCm39)	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46,211,217 (GRCm39)	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	45,992,165 (GRCm39)	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45,969,009 (GRCm39)	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46,965,726 (GRCm39)	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	45,992,373 (GRCm39)	frame shift	probably null
R9745:Cntnap2	UTSW	6	46,211,100 (GRCm39)	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47,026,261 (GRCm39)	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	46,998,599 (GRCm39)	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	45,986,452 (GRCm39)	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	46,998,688 (GRCm39)	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46,211,179 (GRCm39)	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47,248,082 (GRCm39)	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	45,992,233 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCTCCATCACAGCAGGCAAG -3'
(R):5'- CACTTTGCTCTCTACAAGGTCAATC -3'

Sequencing Primer
(F):5'- GACTGGTATTGCATGCTACAC -3'
(R):5'- TCTACAAGGTCAATCTCCACATTG -3'

Posted On

2018-06-22