Incidental Mutation 'R6596:Olfr1166'
ID525950
Institutional Source Beutler Lab
Gene Symbol Olfr1166
Ensembl Gene ENSMUSG00000101078
Gene Nameolfactory receptor 1166
SynonymsGA_x6K02T2Q125-49616865-49615915, MOR174-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6596 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88123360-88128272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88124199 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 262 (C262Y)
Ref Sequence ENSEMBL: ENSMUSP00000149099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099833] [ENSMUST00000217575]
Predicted Effect probably damaging
Transcript: ENSMUST00000099833
AA Change: C262Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097421
Gene: ENSMUSG00000101078
AA Change: C262Y

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 6e-51 PFAM
Pfam:7tm_1 43 292 3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217575
AA Change: C262Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,785 C135S possibly damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Cldn15 T A 5: 136,974,679 C178* probably null Het
Col7a1 C A 9: 108,954,341 probably benign Het
Crnn G A 3: 93,146,875 E22K probably damaging Het
Dcstamp A C 15: 39,754,209 T5P possibly damaging Het
Dennd4a A G 9: 64,852,420 Y269C probably damaging Het
Dsg1c T A 18: 20,270,524 probably null Het
Duox2 C T 2: 122,285,338 V972I probably benign Het
Ephb1 A C 9: 102,194,802 Y259* probably null Het
Fam149a G T 8: 45,381,630 T44K probably benign Het
Fn1 A G 1: 71,609,482 Y1423H probably damaging Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gfm2 C T 13: 97,165,149 P487S probably damaging Het
Gm5039 C A 12: 88,321,287 L65F possibly damaging Het
Hyou1 A G 9: 44,387,755 E625G probably benign Het
Kmt5a G A 5: 124,450,696 V121M probably benign Het
Mindy4 T C 6: 55,224,016 S229P probably damaging Het
Muc16 T C 9: 18,566,715 D7098G probably benign Het
Nsf A T 11: 103,910,457 I244N probably damaging Het
Obox1 C T 7: 15,555,376 S72L probably damaging Het
Olfr1270 T A 2: 90,149,278 T243S possibly damaging Het
Pcdhb7 A T 18: 37,343,361 I517F probably damaging Het
Plk2 C T 13: 110,397,762 A292V probably benign Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Rasgrf1 A T 9: 90,012,794 N1089I possibly damaging Het
Robo2 T A 16: 73,971,108 N603Y probably damaging Het
Slc35f4 G A 14: 49,525,600 A5V probably damaging Het
Smc4 A T 3: 69,025,893 I616F probably damaging Het
Sorl1 T G 9: 42,001,603 N1361H possibly damaging Het
Syngr1 C T 15: 80,111,692 T144M probably damaging Het
Tbc1d16 A C 11: 119,157,775 W351G probably damaging Het
Tbx15 A G 3: 99,352,192 S460G probably benign Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Tpte T C 8: 22,333,269 L304P probably damaging Het
Tubgcp5 T A 7: 55,806,634 F325I probably benign Het
Ucp3 A T 7: 100,481,933 I198F probably benign Het
Vit T C 17: 78,622,845 V413A probably benign Het
Xrcc6 T C 15: 82,022,954 M1T probably null Het
Other mutations in Olfr1166
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1166 APN 2 88124679 missense probably damaging 1.00
R1037:Olfr1166 UTSW 2 88124229 missense probably damaging 0.97
R1452:Olfr1166 UTSW 2 88124311 missense probably benign 0.01
R1842:Olfr1166 UTSW 2 88124127 missense probably damaging 1.00
R2005:Olfr1166 UTSW 2 88124547 missense probably damaging 1.00
R4106:Olfr1166 UTSW 2 88124473 missense possibly damaging 0.67
R4930:Olfr1166 UTSW 2 88124340 missense probably benign 0.08
R5473:Olfr1166 UTSW 2 88124637 missense possibly damaging 0.94
R5911:Olfr1166 UTSW 2 88124683 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCTATATCTGAGTCTTGCC -3'
(R):5'- GAGTACTCCGCTGTCATCTCTG -3'

Sequencing Primer
(F):5'- TGAGTCTTGCCATCACATACAC -3'
(R):5'- AGCCAGTTGACATCCTTAGTCATTG -3'
Posted On2018-06-22