Incidental Mutation 'R6596:Tbx15'
ID 525960
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 044720-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R6596 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99259508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 460 (S460G)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably benign
Transcript: ENSMUST00000029462
AA Change: S460G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: S460G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,819,984 (GRCm39) C135S possibly damaging Het
Bag4 C T 8: 26,259,528 (GRCm39) D224N probably damaging Het
Cldn15 T A 5: 137,003,533 (GRCm39) C178* probably null Het
Col7a1 C A 9: 108,783,409 (GRCm39) probably benign Het
Crnn G A 3: 93,054,182 (GRCm39) E22K probably damaging Het
Dcstamp A C 15: 39,617,605 (GRCm39) T5P possibly damaging Het
Dennd4a A G 9: 64,759,702 (GRCm39) Y269C probably damaging Het
Dsg1c T A 18: 20,403,581 (GRCm39) probably null Het
Duox2 C T 2: 122,115,819 (GRCm39) V972I probably benign Het
Eif1ad15 C A 12: 88,288,057 (GRCm39) L65F possibly damaging Het
Ephb1 A C 9: 102,072,001 (GRCm39) Y259* probably null Het
Fam149a G T 8: 45,834,667 (GRCm39) T44K probably benign Het
Fn1 A G 1: 71,648,641 (GRCm39) Y1423H probably damaging Het
Garem1 T A 18: 21,281,796 (GRCm39) I187F probably damaging Het
Gfm2 C T 13: 97,301,657 (GRCm39) P487S probably damaging Het
Hyou1 A G 9: 44,299,052 (GRCm39) E625G probably benign Het
Kmt5a G A 5: 124,588,759 (GRCm39) V121M probably benign Het
Mindy4 T C 6: 55,201,001 (GRCm39) S229P probably damaging Het
Muc16 T C 9: 18,478,011 (GRCm39) D7098G probably benign Het
Nsf A T 11: 103,801,283 (GRCm39) I244N probably damaging Het
Obox1 C T 7: 15,289,301 (GRCm39) S72L probably damaging Het
Or4b1 T A 2: 89,979,622 (GRCm39) T243S possibly damaging Het
Or5d38 C T 2: 87,954,543 (GRCm39) C262Y probably damaging Het
Pcdhb7 A T 18: 37,476,414 (GRCm39) I517F probably damaging Het
Plk2 C T 13: 110,534,296 (GRCm39) A292V probably benign Het
Pomgnt2 T C 9: 121,811,320 (GRCm39) E487G possibly damaging Het
Rasgrf1 A T 9: 89,894,847 (GRCm39) N1089I possibly damaging Het
Robo2 T A 16: 73,767,996 (GRCm39) N603Y probably damaging Het
Slc35f4 G A 14: 49,763,057 (GRCm39) A5V probably damaging Het
Smc4 A T 3: 68,933,226 (GRCm39) I616F probably damaging Het
Sorl1 T G 9: 41,912,899 (GRCm39) N1361H possibly damaging Het
Syngr1 C T 15: 79,995,893 (GRCm39) T144M probably damaging Het
Tbc1d16 A C 11: 119,048,601 (GRCm39) W351G probably damaging Het
Tns2 G A 15: 102,018,994 (GRCm39) R395Q probably benign Het
Tpte T C 8: 22,823,285 (GRCm39) L304P probably damaging Het
Tubgcp5 T A 7: 55,456,382 (GRCm39) F325I probably benign Het
Ucp3 A T 7: 100,131,140 (GRCm39) I198F probably benign Het
Vit T C 17: 78,930,274 (GRCm39) V413A probably benign Het
Xrcc6 T C 15: 81,907,155 (GRCm39) M1T probably null Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTATCCACCATGTGCCCG -3'
(R):5'- TTCTCTGGGCTTGCAGCTAG -3'

Sequencing Primer
(F):5'- GAAGCAACATGGCTGCCTTAC -3'
(R):5'- GGGGAAATTGTATCCATACAGATTG -3'
Posted On 2018-06-22