Incidental Mutation 'R6644:0610037L13Rik'
List |< first << previous [record 54 of 398669] next >> last >|
ID525990
Institutional Source Beutler Lab
Gene Symbol 0610037L13Rik
Ensembl Gene ENSMUSG00000028608
Gene NameRIKEN cDNA 0610037L13 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6644 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107889813-107899384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107894922 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 130 (I130S)
Ref Sequence ENSEMBL: ENSMUSP00000119565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106726] [ENSMUST00000106727] [ENSMUST00000119394] [ENSMUST00000120473] [ENSMUST00000125107] [ENSMUST00000128474] [ENSMUST00000132417] [ENSMUST00000134254] [ENSMUST00000135454]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030347
Predicted Effect probably benign
Transcript: ENSMUST00000106726
SMART Domains Protein: ENSMUSP00000102337
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 1 114 1.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106727
AA Change: I130S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102338
Gene: ENSMUSG00000028608
AA Change: I130S

DomainStartEndE-ValueType
Pfam:DUF866 1 154 1.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119394
AA Change: I130S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113991
Gene: ENSMUSG00000028608
AA Change: I130S

DomainStartEndE-ValueType
Pfam:DUF866 1 146 8.1e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120473
AA Change: I130S

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113866
Gene: ENSMUSG00000028608
AA Change: I130S

DomainStartEndE-ValueType
Pfam:DUF866 1 138 2.7e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125107
AA Change: I166S

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119565
Gene: ENSMUSG00000028608
AA Change: I166S

DomainStartEndE-ValueType
Pfam:DUF866 40 194 2.2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127715
Predicted Effect probably benign
Transcript: ENSMUST00000128474
SMART Domains Protein: ENSMUSP00000115797
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 2 66 4.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132417
SMART Domains Protein: ENSMUSP00000117717
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 37 98 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000134254
AA Change: I31S

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119309
Gene: ENSMUSG00000028608
AA Change: I31S

DomainStartEndE-ValueType
Pfam:DUF866 1 46 3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135454
AA Change: I130S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114234
Gene: ENSMUSG00000028608
AA Change: I130S

DomainStartEndE-ValueType
Pfam:DUF866 1 160 1.7e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156888
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 C T 10: 80,008,764 P1461L probably damaging Het
Abhd14a T C 9: 106,444,273 Y10C probably damaging Het
Adcy2 C T 13: 68,668,552 V772M possibly damaging Het
Apob A G 12: 8,009,077 M2487V probably damaging Het
B4galnt1 T C 10: 127,171,793 L521P probably null Het
Cabp7 C T 11: 4,740,396 V76I probably benign Het
Cbr3 A G 16: 93,690,511 Y194C probably damaging Het
Cdk18 G A 1: 132,122,069 Q58* probably null Het
Cryba4 T C 5: 112,246,762 D167G probably damaging Het
Dner T C 1: 84,395,707 N588S probably damaging Het
Dnm1l T C 16: 16,329,873 I343V probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam71d T A 12: 78,715,286 D241E probably damaging Het
Fbxw17 G A 13: 50,423,219 R49Q probably damaging Het
Gm10332 T A 14: 54,820,159 F59I probably damaging Het
Gm6803 A G 12: 88,018,690 F28L probably benign Het
Gm8765 A G 13: 50,702,035 T570A possibly damaging Het
Gnai3 A G 3: 108,123,536 probably null Het
Helz T A 11: 107,632,261 M757K possibly damaging Het
Hnrnph3 C T 10: 63,018,893 E40K probably benign Het
Ifi211 C T 1: 173,905,552 C181Y probably benign Het
Immp1l A G 2: 105,937,045 K83R probably damaging Het
Itga6 G A 2: 71,841,124 G740R probably damaging Het
Klhl1 T C 14: 96,517,918 T134A probably benign Het
Klhl7 A G 5: 24,149,246 D353G probably damaging Het
Map3k1 A G 13: 111,752,449 S1325P probably benign Het
Map3k4 A G 17: 12,232,410 probably null Het
Meioc G A 11: 102,668,460 probably null Het
Mfap5 T C 6: 122,520,596 F38L probably damaging Het
Myo5a A G 9: 75,146,967 T386A probably damaging Het
Npc1l1 A T 11: 6,214,013 L1266Q probably damaging Het
Npc1l1 G T 11: 6,214,014 L1266M probably damaging Het
Olfr1221 A G 2: 89,111,981 M177T probably benign Het
Olfr612 C A 7: 103,539,058 V59F possibly damaging Het
Pbld1 T A 10: 63,075,063 S233T probably damaging Het
Phf12 A G 11: 78,026,092 *789W probably null Het
Sf3b2 A T 19: 5,279,964 probably null Het
Slc23a3 A G 1: 75,128,547 I459T probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Stard9 A C 2: 120,695,772 M837L probably benign Het
Stx5a A T 19: 8,755,248 Y427F probably benign Het
Tmc7 A G 7: 118,538,162 V719A probably benign Het
Trank1 T A 9: 111,364,834 I642K possibly damaging Het
Trim34a T C 7: 104,261,037 Y349H probably damaging Het
Uba7 A G 9: 107,981,472 Y834C possibly damaging Het
Ube2d1 A G 10: 71,256,700 S105P possibly damaging Het
Vps13a A G 19: 16,744,919 V343A possibly damaging Het
Zbtb37 G A 1: 161,032,073 Q221* probably null Het
Zfp119b T C 17: 55,939,148 N346S probably benign Het
Zfp708 G T 13: 67,070,721 T358K possibly damaging Het
Other mutations in 0610037L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:0610037L13Rik APN 4 107894868 unclassified probably benign
R0787:0610037L13Rik UTSW 4 107890129 missense probably damaging 1.00
R3500:0610037L13Rik UTSW 4 107891513 missense probably damaging 1.00
R4778:0610037L13Rik UTSW 4 107891998 missense probably damaging 1.00
R5940:0610037L13Rik UTSW 4 107893288 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCGAGTAAGTTGGGAAC -3'
(R):5'- TTCACAGGTCCTCCTCAGAACC -3'

Sequencing Primer
(F):5'- TTTGCTAGGAAGAGCAGC -3'
(R):5'- AGAACCCTGGCCTGCTAGAG -3'
Posted OnJun 22, 2018