Incidental Mutation 'R6596:Plk2'
ID526005
Institutional Source Beutler Lab
Gene Symbol Plk2
Ensembl Gene ENSMUSG00000021701
Gene Namepolo like kinase 2
SynonymsSnk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6596 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location110395046-110400844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110397762 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 292 (A292V)
Ref Sequence ENSEMBL: ENSMUSP00000022212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022212]
Predicted Effect probably benign
Transcript: ENSMUST00000022212
AA Change: A292V

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: A292V

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
S_TKc 79 331 7.08e-97 SMART
Blast:STYKc 335 383 9e-7 BLAST
low complexity region 448 464 N/A INTRINSIC
Pfam:POLO_box 508 569 2.5e-19 PFAM
Pfam:POLO_box 604 673 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225340
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik T A 9: 101,942,785 C135S possibly damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Cldn15 T A 5: 136,974,679 C178* probably null Het
Col7a1 C A 9: 108,954,341 probably benign Het
Crnn G A 3: 93,146,875 E22K probably damaging Het
Dcstamp A C 15: 39,754,209 T5P possibly damaging Het
Dennd4a A G 9: 64,852,420 Y269C probably damaging Het
Dsg1c T A 18: 20,270,524 probably null Het
Duox2 C T 2: 122,285,338 V972I probably benign Het
Ephb1 A C 9: 102,194,802 Y259* probably null Het
Fam149a G T 8: 45,381,630 T44K probably benign Het
Fn1 A G 1: 71,609,482 Y1423H probably damaging Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gfm2 C T 13: 97,165,149 P487S probably damaging Het
Gm5039 C A 12: 88,321,287 L65F possibly damaging Het
Hyou1 A G 9: 44,387,755 E625G probably benign Het
Kmt5a G A 5: 124,450,696 V121M probably benign Het
Mindy4 T C 6: 55,224,016 S229P probably damaging Het
Muc16 T C 9: 18,566,715 D7098G probably benign Het
Nsf A T 11: 103,910,457 I244N probably damaging Het
Obox1 C T 7: 15,555,376 S72L probably damaging Het
Olfr1166 C T 2: 88,124,199 C262Y probably damaging Het
Olfr1270 T A 2: 90,149,278 T243S possibly damaging Het
Pcdhb7 A T 18: 37,343,361 I517F probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Rasgrf1 A T 9: 90,012,794 N1089I possibly damaging Het
Robo2 T A 16: 73,971,108 N603Y probably damaging Het
Slc35f4 G A 14: 49,525,600 A5V probably damaging Het
Smc4 A T 3: 69,025,893 I616F probably damaging Het
Sorl1 T G 9: 42,001,603 N1361H possibly damaging Het
Syngr1 C T 15: 80,111,692 T144M probably damaging Het
Tbc1d16 A C 11: 119,157,775 W351G probably damaging Het
Tbx15 A G 3: 99,352,192 S460G probably benign Het
Tns2 G A 15: 102,110,559 R395Q probably benign Het
Tpte T C 8: 22,333,269 L304P probably damaging Het
Tubgcp5 T A 7: 55,806,634 F325I probably benign Het
Ucp3 A T 7: 100,481,933 I198F probably benign Het
Vit T C 17: 78,622,845 V413A probably benign Het
Xrcc6 T C 15: 82,022,954 M1T probably null Het
Other mutations in Plk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Plk2 APN 13 110398764 missense probably benign 0.18
IGL00586:Plk2 APN 13 110396378 missense possibly damaging 0.61
IGL00798:Plk2 APN 13 110398034 missense probably benign 0.00
IGL01450:Plk2 APN 13 110396324 missense probably damaging 1.00
IGL01722:Plk2 APN 13 110399442 missense probably benign 0.00
IGL01937:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01945:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01993:Plk2 APN 13 110399197 missense probably damaging 1.00
IGL02231:Plk2 APN 13 110400069 missense probably benign 0.01
IGL03059:Plk2 APN 13 110399134 missense probably benign 0.42
Mite UTSW 13 110396036 nonsense probably null
R0189:Plk2 UTSW 13 110399463 missense probably damaging 1.00
R0324:Plk2 UTSW 13 110397708 missense probably benign 0.08
R1108:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1422:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1513:Plk2 UTSW 13 110400088 missense probably benign 0.45
R2987:Plk2 UTSW 13 110397709 missense probably benign 0.03
R4050:Plk2 UTSW 13 110399866 missense probably damaging 1.00
R4211:Plk2 UTSW 13 110396337 missense probably damaging 0.98
R4278:Plk2 UTSW 13 110396103 missense probably benign 0.15
R4777:Plk2 UTSW 13 110397773 missense probably benign
R5121:Plk2 UTSW 13 110399424 missense probably benign 0.01
R5677:Plk2 UTSW 13 110399057 missense possibly damaging 0.83
R6240:Plk2 UTSW 13 110399474 missense probably damaging 1.00
R6240:Plk2 UTSW 13 110400034 missense probably damaging 1.00
R6436:Plk2 UTSW 13 110396036 nonsense probably null
R6776:Plk2 UTSW 13 110399791 missense probably benign
R6938:Plk2 UTSW 13 110396680 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGAATCAGACATCTGGGCC -3'
(R):5'- TGTGGAACCAGAAGAGACCATC -3'

Sequencing Primer
(F):5'- AATCAGACATCTGGGCCTTAGGC -3'
(R):5'- TCTCCAGCAACCAGGACGATG -3'
Posted On2018-06-22