Incidental Mutation 'R6645:Fh1'
ID526050
Institutional Source Beutler Lab
Gene Symbol Fh1
Ensembl Gene ENSMUSG00000026526
Gene Namefumarate hydratase 1
Synonymsfumarase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175600374-175625635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 175614876 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 136 (V136E)
Ref Sequence ENSEMBL: ENSMUSP00000027810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027810] [ENSMUST00000154956]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027810
AA Change: V136E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: V136E

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Lyase_1 55 386 1.8e-124 PFAM
Pfam:FumaraseC_C 452 505 2.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154956
SMART Domains Protein: ENSMUSP00000135140
Gene: ENSMUSG00000026526

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Fh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fh1 APN 1 175601542 missense probably damaging 1.00
IGL02637:Fh1 APN 1 175609766 missense probably benign 0.00
IGL02954:Fh1 APN 1 175609735 missense probably damaging 1.00
IGL03056:Fh1 APN 1 175606162 missense probably damaging 1.00
IGL03309:Fh1 APN 1 175604043 missense probably benign 0.01
R0729:Fh1 UTSW 1 175614817 missense probably damaging 1.00
R1240:Fh1 UTSW 1 175604015 missense probably damaging 1.00
R1327:Fh1 UTSW 1 175609744 missense probably benign 0.32
R1576:Fh1 UTSW 1 175607819 missense probably null 1.00
R1779:Fh1 UTSW 1 175601424 makesense probably null
R1823:Fh1 UTSW 1 175616548 missense probably damaging 1.00
R1851:Fh1 UTSW 1 175607886 missense probably damaging 1.00
R1943:Fh1 UTSW 1 175609778 missense probably benign
R2163:Fh1 UTSW 1 175614840 missense possibly damaging 0.80
R3766:Fh1 UTSW 1 175614750 missense probably damaging 1.00
R4193:Fh1 UTSW 1 175614841 missense possibly damaging 0.51
R4672:Fh1 UTSW 1 175604051 missense probably benign 0.07
R4812:Fh1 UTSW 1 175601459 missense probably damaging 0.99
R4849:Fh1 UTSW 1 175620506 missense probably benign 0.00
R4905:Fh1 UTSW 1 175619073 missense probably damaging 1.00
R4978:Fh1 UTSW 1 175603967 missense probably damaging 1.00
R6681:Fh1 UTSW 1 175619124 missense probably null 0.71
R7075:Fh1 UTSW 1 175607855 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGTCAGTCTATCCCGACGAG -3'
(R):5'- TGCCACAGCTGCCTTTAACTG -3'

Sequencing Primer
(F):5'- TCTATCCCGACGAGGCAGAG -3'
(R):5'- TTAGCAAGCCACTTAGCGTG -3'
Posted On2018-06-22