Incidental Mutation 'R6645:Olfr902'
ID526072
Institutional Source Beutler Lab
Gene Symbol Olfr902
Ensembl Gene ENSMUSG00000049334
Gene Nameolfactory receptor 902
SynonymsGA_x6K02T2PVTD-32141623-32142552, MOR169-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38447652-38450576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38448923 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 17 (L17S)
Ref Sequence ENSEMBL: ENSMUSP00000151061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050733] [ENSMUST00000213105]
Predicted Effect probably damaging
Transcript: ENSMUST00000050733
AA Change: L17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055975
Gene: ENSMUSG00000049334
AA Change: L17S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-48 PFAM
Pfam:7tm_1 41 289 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213105
AA Change: L17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Olfr902
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01738:Olfr902 APN 9 38449646 missense probably damaging 0.97
IGL02149:Olfr902 APN 9 38449397 missense probably damaging 0.97
IGL02869:Olfr902 APN 9 38449193 missense possibly damaging 0.75
IGL02945:Olfr902 APN 9 38449516 missense probably benign 0.00
IGL03269:Olfr902 APN 9 38448901 missense probably benign 0.13
R1955:Olfr902 UTSW 9 38449688 missense probably benign 0.13
R2182:Olfr902 UTSW 9 38449124 missense probably benign 0.21
R2864:Olfr902 UTSW 9 38449388 missense possibly damaging 0.89
R4423:Olfr902 UTSW 9 38449366 missense probably benign 0.03
R4938:Olfr902 UTSW 9 38449383 missense probably benign 0.10
R5537:Olfr902 UTSW 9 38449242 nonsense probably null
R6861:Olfr902 UTSW 9 38449435 missense probably damaging 1.00
R6951:Olfr902 UTSW 9 38448938 missense probably benign 0.00
R7568:Olfr902 UTSW 9 38449646 missense not run
Predicted Primers PCR Primer
(F):5'- TTGCTTGCAACTACAACAACTG -3'
(R):5'- GCATATAGGAAATGGCATTCTGTC -3'

Sequencing Primer
(F):5'- CAACTGCTTCTGTAGAAATAGTGGG -3'
(R):5'- CAACATTTTTGGAGTGAACACAG -3'
Posted On2018-06-22