Incidental Mutation 'R6645:Cilp'
ID526074
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Namecartilage intermediate layer protein, nucleotide pyrophosphohydrolase
SynonymsC130036G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location65265180-65280605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65279305 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 894 (Y894F)
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048762
AA Change: Y894F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254
AA Change: Y894F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Washc4 C T 10: 83,572,195 R555* probably null Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65278983 missense possibly damaging 0.80
IGL01340:Cilp APN 9 65275974 missense probably damaging 0.99
IGL02330:Cilp APN 9 65274522 splice site probably benign
IGL02729:Cilp APN 9 65278090 missense possibly damaging 0.63
IGL02833:Cilp APN 9 65277924 missense probably benign
IGL02961:Cilp APN 9 65278609 missense possibly damaging 0.88
IGL03137:Cilp APN 9 65278168 missense probably benign
IGL03211:Cilp APN 9 65280175 missense probably benign
IGL03301:Cilp APN 9 65280217 missense probably benign 0.01
IGL03341:Cilp APN 9 65278002 missense probably benign 0.07
ANU05:Cilp UTSW 9 65278983 missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65280130 frame shift probably null
IGL02988:Cilp UTSW 9 65280130 frame shift probably null
IGL02991:Cilp UTSW 9 65280130 frame shift probably null
IGL03014:Cilp UTSW 9 65280130 frame shift probably null
IGL03050:Cilp UTSW 9 65280130 frame shift probably null
IGL03054:Cilp UTSW 9 65280130 frame shift probably null
IGL03055:Cilp UTSW 9 65280130 frame shift probably null
IGL03097:Cilp UTSW 9 65280130 frame shift probably null
IGL03098:Cilp UTSW 9 65280130 frame shift probably null
IGL03134:Cilp UTSW 9 65280130 frame shift probably null
IGL03138:Cilp UTSW 9 65280130 frame shift probably null
IGL03147:Cilp UTSW 9 65280130 frame shift probably null
R0096:Cilp UTSW 9 65273670 missense possibly damaging 0.57
R0219:Cilp UTSW 9 65269590 missense possibly damaging 0.64
R0347:Cilp UTSW 9 65280153 missense probably benign
R0699:Cilp UTSW 9 65270326 missense probably damaging 1.00
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1155:Cilp UTSW 9 65269587 missense probably benign 0.01
R1544:Cilp UTSW 9 65275845 missense probably benign 0.03
R1584:Cilp UTSW 9 65279715 missense probably damaging 1.00
R1586:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2055:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2069:Cilp UTSW 9 65278090 missense possibly damaging 0.63
R2070:Cilp UTSW 9 65279095 missense probably damaging 1.00
R2414:Cilp UTSW 9 65274645 splice site probably benign
R4284:Cilp UTSW 9 65278278 missense probably damaging 1.00
R4630:Cilp UTSW 9 65279880 missense probably benign 0.17
R4632:Cilp UTSW 9 65279880 missense probably benign 0.17
R4870:Cilp UTSW 9 65279698 missense probably damaging 1.00
R4908:Cilp UTSW 9 65278020 missense probably benign 0.17
R5568:Cilp UTSW 9 65280233 missense probably benign 0.04
R5621:Cilp UTSW 9 65278791 missense possibly damaging 0.71
R5889:Cilp UTSW 9 65280343 missense possibly damaging 0.93
R6878:Cilp UTSW 9 65279847 missense probably damaging 1.00
R6982:Cilp UTSW 9 65279805 missense probably damaging 1.00
R7330:Cilp UTSW 9 65280245 missense probably benign
X0024:Cilp UTSW 9 65279643 missense probably damaging 1.00
X0025:Cilp UTSW 9 65279698 missense probably damaging 1.00
Z1088:Cilp UTSW 9 65280130 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGTCTTGGCAAGCCTTTCTG -3'
(R):5'- ATATAGCAGGCCCTGAACTCC -3'

Sequencing Primer
(F):5'- AACTAGAGGCAGTTGAGTCTTCTCC -3'
(R):5'- AACTCCATTGGCTTGGGC -3'
Posted On2018-06-22