Incidental Mutation 'R6645:Washc4'
ID526080
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R6645 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 83572195 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 555 (R555*)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably null
Transcript: ENSMUST00000038388
AA Change: R555*
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: R555*

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,117 D994V probably benign Het
Anp32e T A 3: 95,937,102 F95I probably damaging Het
Arap1 A G 7: 101,408,111 K628R possibly damaging Het
Arid4b A T 13: 14,120,152 E6D probably damaging Het
Atxn10 G T 15: 85,376,703 probably null Het
Ccdc170 A G 10: 4,560,974 I678V possibly damaging Het
Ccdc18 T A 5: 108,138,930 V110D probably benign Het
Cep85l C T 10: 53,301,672 E322K probably benign Het
Cilp A T 9: 65,279,305 Y894F possibly damaging Het
Ddx4 A G 13: 112,641,174 S62P possibly damaging Het
Dph7 T C 2: 24,965,651 V154A probably benign Het
Ephb6 T C 6: 41,617,272 S579P probably benign Het
Fam53a G T 5: 33,600,784 Q332K probably benign Het
Fancm A G 12: 65,106,100 D1110G probably damaging Het
Fh1 A T 1: 175,614,876 V136E possibly damaging Het
Greb1 G T 12: 16,698,579 H1132Q probably benign Het
Jph1 A G 1: 17,091,761 S226P probably damaging Het
Kbtbd8 C T 6: 95,126,749 R460* probably null Het
Lama5 T A 2: 180,179,670 N3059Y probably damaging Het
Lipc G A 9: 70,803,748 T289I probably damaging Het
Lrrc2 T C 9: 110,970,107 W241R probably damaging Het
Mfn2 T A 4: 147,894,612 I88F probably damaging Het
Mms19 G C 19: 41,955,191 N366K probably benign Het
Myo15 A G 11: 60,477,292 T293A probably benign Het
Ndfip2 T A 14: 105,292,273 Y179N probably damaging Het
Notch4 A G 17: 34,587,816 D1909G probably benign Het
Obscn C T 11: 59,085,262 S2013N probably damaging Het
Oca2 G T 7: 56,314,774 A357S probably benign Het
Olfr902 T C 9: 38,448,923 L17S probably damaging Het
Olfr955 T A 9: 39,470,266 L153F probably benign Het
Pde7b C A 10: 20,610,566 probably null Het
Ppef2 T C 5: 92,230,461 N625S probably benign Het
Prom1 A T 5: 44,047,514 L192Q probably damaging Het
Satb2 T C 1: 56,797,007 I542V possibly damaging Het
Sgpp2 C T 1: 78,360,162 T59M probably damaging Het
Skint6 T C 4: 112,892,038 T782A possibly damaging Het
Slc13a4 G T 6: 35,268,839 Q624K probably benign Het
Slc9a3 T A 13: 74,164,172 H629Q probably damaging Het
Slitrk3 G T 3: 73,049,861 A526E probably benign Het
Sptssa T C 12: 54,646,490 Y53C probably damaging Het
Srsf10 T C 4: 135,863,563 S159P possibly damaging Het
Tbce T C 13: 14,005,229 T341A probably benign Het
Tdrd6 A G 17: 43,624,532 L1875P probably benign Het
Tkt G A 14: 30,570,211 G425R probably damaging Het
Tmprss7 T C 16: 45,690,963 I17M possibly damaging Het
Ttc21b T C 2: 66,236,377 S311G probably benign Het
Ubr5 A G 15: 38,029,506 Y492H probably damaging Het
Ush2a T C 1: 188,523,331 I1535T probably damaging Het
Vmn2r17 A T 5: 109,428,381 N373Y probably damaging Het
Vmn2r6 A T 3: 64,556,876 V179E probably damaging Het
Vps13b A G 15: 35,910,305 E3405G probably benign Het
Wac A T 18: 7,973,523 Q212H probably damaging Het
Zmat4 G A 8: 23,797,401 probably null Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GAGAAGACACTTTGTTTCCTTTGG -3'
(R):5'- AAGCTCGCTGATAAGATCCAGC -3'

Sequencing Primer
(F):5'- TCCTTTGGAAACTTAACCATGTTAG -3'
(R):5'- GCTGATAAGATCCAGCTTCTTCATG -3'
Posted On2018-06-22