Incidental Mutation 'R6570:Rnf168'
ID 526219
Institutional Source Beutler Lab
Gene Symbol Rnf168
Ensembl Gene ENSMUSG00000014074
Gene Name ring finger protein 168
Synonyms 3110001H15Rik
MMRRC Submission 044694-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.913) question?
Stock # R6570 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 32096277-32120252 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32108028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 219 (S219N)
Ref Sequence ENSEMBL: ENSMUSP00000126484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014218] [ENSMUST00000155649] [ENSMUST00000171474]
AlphaFold Q80XJ2
Predicted Effect probably benign
Transcript: ENSMUST00000014218
AA Change: S217N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000014218
Gene: ENSMUSG00000014074
AA Change: S217N

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 184 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155649
SMART Domains Protein: ENSMUSP00000115807
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171474
AA Change: S219N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126484
Gene: ENSMUSG00000014074
AA Change: S219N

DomainStartEndE-ValueType
RING 18 56 8.23e-6 SMART
coiled coil region 116 186 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase protein that contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The protein is involved in DNA double-strand break (DSB) repair. Mutations in this gene result in Riddle syndrome. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit immunodeficient, increased radiosensitivity and age-dependent reduction in male infertility. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Gene trapped(56)

Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 T C 8: 123,584,130 (GRCm39) V77A probably damaging Het
Cfap54 C T 10: 92,651,820 (GRCm39) V3077I unknown Het
Erbb2 T C 11: 98,313,873 (GRCm39) L272P possibly damaging Het
Exd1 T C 2: 119,350,654 (GRCm39) T536A probably benign Het
Hoxc9 A T 15: 102,890,185 (GRCm39) H34L probably benign Het
Kif19a G T 11: 114,675,731 (GRCm39) R401L possibly damaging Het
Mad2l1bp A T 17: 46,463,933 (GRCm39) H30Q probably benign Het
Mettl13 A G 1: 162,371,855 (GRCm39) L26P probably damaging Het
Mmp16 G A 4: 18,011,501 (GRCm39) V110I possibly damaging Het
Or2m13 T C 16: 19,226,068 (GRCm39) S233G probably benign Het
Plcb4 C T 2: 135,824,906 (GRCm39) A863V probably benign Het
Serpine3 T A 14: 62,911,770 (GRCm39) L244Q probably damaging Het
Vmn1r75 T C 7: 11,614,883 (GRCm39) V205A probably damaging Het
Zscan4d A G 7: 10,895,927 (GRCm39) V481A possibly damaging Het
Other mutations in Rnf168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02997:Rnf168 APN 16 32,104,239 (GRCm39) missense probably damaging 1.00
IGL03108:Rnf168 APN 16 32,097,099 (GRCm39) missense possibly damaging 0.79
P0021:Rnf168 UTSW 16 32,117,705 (GRCm39) missense probably damaging 0.96
R0038:Rnf168 UTSW 16 32,117,813 (GRCm39) missense probably benign 0.05
R0038:Rnf168 UTSW 16 32,117,813 (GRCm39) missense probably benign 0.05
R0040:Rnf168 UTSW 16 32,096,991 (GRCm39) splice site probably null
R0049:Rnf168 UTSW 16 32,117,287 (GRCm39) missense possibly damaging 0.56
R0049:Rnf168 UTSW 16 32,117,287 (GRCm39) missense possibly damaging 0.56
R0760:Rnf168 UTSW 16 32,117,204 (GRCm39) critical splice acceptor site probably null
R1188:Rnf168 UTSW 16 32,117,477 (GRCm39) missense probably benign 0.00
R1386:Rnf168 UTSW 16 32,117,781 (GRCm39) missense probably damaging 1.00
R1754:Rnf168 UTSW 16 32,117,942 (GRCm39) missense probably benign
R2118:Rnf168 UTSW 16 32,097,036 (GRCm39) missense probably damaging 1.00
R2122:Rnf168 UTSW 16 32,097,036 (GRCm39) missense probably damaging 1.00
R2124:Rnf168 UTSW 16 32,097,036 (GRCm39) missense probably damaging 1.00
R2520:Rnf168 UTSW 16 32,097,221 (GRCm39) missense probably benign 0.17
R2852:Rnf168 UTSW 16 32,101,192 (GRCm39) missense probably damaging 0.99
R3418:Rnf168 UTSW 16 32,118,010 (GRCm39) missense probably benign 0.00
R3419:Rnf168 UTSW 16 32,118,010 (GRCm39) missense probably benign 0.00
R4886:Rnf168 UTSW 16 32,118,014 (GRCm39) missense probably benign 0.00
R5335:Rnf168 UTSW 16 32,117,402 (GRCm39) missense possibly damaging 0.78
R5738:Rnf168 UTSW 16 32,101,192 (GRCm39) missense probably damaging 0.99
R7165:Rnf168 UTSW 16 32,101,179 (GRCm39) missense probably benign 0.38
R7529:Rnf168 UTSW 16 32,117,732 (GRCm39) missense probably damaging 0.98
R7556:Rnf168 UTSW 16 32,117,863 (GRCm39) missense probably damaging 1.00
R9338:Rnf168 UTSW 16 32,110,801 (GRCm39) critical splice donor site probably null
R9796:Rnf168 UTSW 16 32,117,872 (GRCm39) missense probably damaging 1.00
R9800:Rnf168 UTSW 16 32,117,386 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCTCACCAGCTCCACCAAGG -3'
(R):5'- TCTTCTGACATCCAAGGGCA -3'

Sequencing Primer
(F):5'- CTGGAACTCACTCTGTAGATCAGG -3'
(R):5'- ACACACTCCATGCATTTACATG -3'
Posted On 2018-06-22