Mutagenetix > Incidental Mutation

Incidental Mutation 'R6627:Elp1'

526324

Institutional Source

Beutler Lab

Gene Symbol

Elp1

Ensembl Gene

ENSMUSG00000028431

Gene Name

elongator complex protein 1

Synonyms

Ikbkap, C78473, 3110040G09Rik, IKAP

MMRRC Submission

044749-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6627 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56749680-56802331 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 56784647 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030140]

AlphaFold

Q7TT37

Predicted Effect

probably null
Transcript: ENSMUST00000030140

SMART Domains

Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431

Domain	Start	End	E-Value	Type
Pfam:IKI3	1	955	N/A	PFAM
low complexity region	1186	1205	N/A	INTRINSIC
low complexity region	1210	1225	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126441

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd29	T	C	18: 12,395,221 (GRCm39)	N224S	probably benign	Het
Ccdc162	A	G	10: 41,539,181 (GRCm39)	S396P	probably damaging	Het
Cd9	A	G	6: 125,439,375 (GRCm39)	L119P	possibly damaging	Het
Cdk17	A	C	10: 93,068,274 (GRCm39)	T311P	probably damaging	Het
Cep89	A	G	7: 35,127,172 (GRCm39)	D511G	possibly damaging	Het
Coq3	T	C	4: 21,908,607 (GRCm39)	V286A	possibly damaging	Het
Cyp2j13	G	A	4: 95,947,343 (GRCm39)	T236I	probably damaging	Het
Ddx46	T	C	13: 55,800,748 (GRCm39)	V301A	probably benign	Het
Dnah10	A	T	5: 124,907,097 (GRCm39)	I4209F	probably damaging	Het
E2f5	G	A	3: 14,668,917 (GRCm39)	E270K	probably benign	Het
Esp24	C	T	17: 39,350,952 (GRCm39)	Q51*	probably null	Het
Fam168b	C	A	1: 34,875,822 (GRCm39)	G21V	probably damaging	Het
Fasn	G	T	11: 120,709,753 (GRCm39)	Q435K	probably benign	Het
Gpr17	T	C	18: 32,080,949 (GRCm39)	Y38C	probably damaging	Het
Lfng	T	C	5: 140,593,523 (GRCm39)	V118A	probably damaging	Het
Maco1	A	G	4: 134,563,654 (GRCm39)	V110A	probably damaging	Het
Muc5ac	T	C	7: 141,362,427 (GRCm39)		probably benign	Het
Myh1	T	G	11: 67,105,835 (GRCm39)	L1150R	probably damaging	Het
Plod3	T	G	5: 137,017,310 (GRCm39)	I111S	probably damaging	Het
Sh2d4a	T	A	8: 68,746,970 (GRCm39)	V66D	probably damaging	Het
Simc1	T	G	13: 54,694,887 (GRCm39)	L323V	probably damaging	Het
Thnsl2	A	G	6: 71,111,199 (GRCm39)	I223T	possibly damaging	Het
Tmem203	T	C	2: 25,145,785 (GRCm39)		probably null	Het
Tmppe	A	G	9: 114,234,553 (GRCm39)	D284G	probably damaging	Het
Ube2s	C	T	7: 4,813,581 (GRCm39)	R61H	possibly damaging	Het

Other mutations in Elp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Elp1	APN	4	56,784,537 (GRCm39)	critical splice donor site	probably null
IGL01521:Elp1	APN	4	56,771,059 (GRCm39)	missense	probably benign	0.27
IGL02069:Elp1	APN	4	56,779,731 (GRCm39)	missense	probably benign	0.31
IGL02162:Elp1	APN	4	56,796,502 (GRCm39)	critical splice donor site	probably null
IGL02252:Elp1	APN	4	56,759,813 (GRCm39)	missense	probably benign	0.09
IGL02726:Elp1	APN	4	56,767,878 (GRCm39)	critical splice acceptor site	probably null
IGL02822:Elp1	APN	4	56,774,520 (GRCm39)	critical splice donor site	probably null
IGL03024:Elp1	APN	4	56,774,686 (GRCm39)	critical splice donor site	probably null
IGL03126:Elp1	APN	4	56,779,717 (GRCm39)	missense	probably benign
R0211:Elp1	UTSW	4	56,795,545 (GRCm39)	missense	probably damaging	1.00
R0239:Elp1	UTSW	4	56,784,596 (GRCm39)	missense	probably benign	0.00
R0239:Elp1	UTSW	4	56,784,596 (GRCm39)	missense	probably benign	0.00
R0603:Elp1	UTSW	4	56,792,105 (GRCm39)	missense	possibly damaging	0.94
R1109:Elp1	UTSW	4	56,786,723 (GRCm39)	missense	probably benign	0.00
R1314:Elp1	UTSW	4	56,786,647 (GRCm39)	missense	probably benign	0.00
R1333:Elp1	UTSW	4	56,770,969 (GRCm39)	splice site	probably benign
R1434:Elp1	UTSW	4	56,781,193 (GRCm39)	missense	probably benign	0.02
R1547:Elp1	UTSW	4	56,798,810 (GRCm39)	missense	probably damaging	1.00
R1547:Elp1	UTSW	4	56,792,090 (GRCm39)	missense	probably damaging	1.00
R1587:Elp1	UTSW	4	56,786,666 (GRCm39)	nonsense	probably null
R1601:Elp1	UTSW	4	56,774,756 (GRCm39)	nonsense	probably null
R2076:Elp1	UTSW	4	56,786,620 (GRCm39)	missense	probably damaging	0.98
R2153:Elp1	UTSW	4	56,779,636 (GRCm39)	splice site	probably null
R2263:Elp1	UTSW	4	56,755,298 (GRCm39)	splice site	probably null
R2325:Elp1	UTSW	4	56,784,622 (GRCm39)	missense	probably benign	0.00
R2333:Elp1	UTSW	4	56,775,456 (GRCm39)	missense	probably benign	0.28
R3151:Elp1	UTSW	4	56,770,985 (GRCm39)	missense	probably benign	0.24
R3622:Elp1	UTSW	4	56,759,925 (GRCm39)	splice site	probably null
R3624:Elp1	UTSW	4	56,798,708 (GRCm39)	missense	possibly damaging	0.52
R3889:Elp1	UTSW	4	56,759,852 (GRCm39)	missense	probably damaging	1.00
R4007:Elp1	UTSW	4	56,794,139 (GRCm39)	missense	probably damaging	1.00
R4196:Elp1	UTSW	4	56,755,353 (GRCm39)	missense	probably damaging	1.00
R4794:Elp1	UTSW	4	56,781,176 (GRCm39)	small deletion	probably benign
R5330:Elp1	UTSW	4	56,800,001 (GRCm39)	missense	probably benign	0.01
R5331:Elp1	UTSW	4	56,800,001 (GRCm39)	missense	probably benign	0.01
R5360:Elp1	UTSW	4	56,800,104 (GRCm39)	missense	probably benign	0.06
R5362:Elp1	UTSW	4	56,778,969 (GRCm39)	missense	probably damaging	0.99
R5645:Elp1	UTSW	4	56,776,920 (GRCm39)	missense	possibly damaging	0.93
R5877:Elp1	UTSW	4	56,787,807 (GRCm39)	missense	probably damaging	1.00
R6268:Elp1	UTSW	4	56,762,305 (GRCm39)	missense	probably damaging	1.00
R6284:Elp1	UTSW	4	56,762,281 (GRCm39)	missense	probably damaging	0.99
R6526:Elp1	UTSW	4	56,798,812 (GRCm39)	critical splice acceptor site	probably null
R6610:Elp1	UTSW	4	56,758,236 (GRCm39)	missense	probably benign	0.02
R6786:Elp1	UTSW	4	56,771,555 (GRCm39)	missense	possibly damaging	0.80
R6823:Elp1	UTSW	4	56,787,939 (GRCm39)	missense	probably damaging	1.00
R7129:Elp1	UTSW	4	56,787,944 (GRCm39)	missense	probably damaging	1.00
R7157:Elp1	UTSW	4	56,781,176 (GRCm39)	small deletion	probably benign
R7180:Elp1	UTSW	4	56,796,535 (GRCm39)	missense	probably damaging	1.00
R7391:Elp1	UTSW	4	56,781,212 (GRCm39)	missense	probably benign	0.00
R7391:Elp1	UTSW	4	56,781,211 (GRCm39)	missense	possibly damaging	0.82
R7403:Elp1	UTSW	4	56,778,994 (GRCm39)	missense	probably damaging	1.00
R7432:Elp1	UTSW	4	56,776,925 (GRCm39)	missense	probably damaging	1.00
R7674:Elp1	UTSW	4	56,792,075 (GRCm39)	missense	probably damaging	0.97
R7736:Elp1	UTSW	4	56,776,920 (GRCm39)	missense	possibly damaging	0.93
R7755:Elp1	UTSW	4	56,774,552 (GRCm39)	missense	possibly damaging	0.80
R7760:Elp1	UTSW	4	56,790,892 (GRCm39)	missense	probably benign	0.20
R7849:Elp1	UTSW	4	56,758,968 (GRCm39)	missense	possibly damaging	0.65
R7959:Elp1	UTSW	4	56,774,737 (GRCm39)	missense	probably damaging	1.00
R7970:Elp1	UTSW	4	56,771,466 (GRCm39)	missense	probably damaging	1.00
R8324:Elp1	UTSW	4	56,772,491 (GRCm39)	missense	probably damaging	1.00
R8456:Elp1	UTSW	4	56,781,176 (GRCm39)	small deletion	probably benign
R8671:Elp1	UTSW	4	56,771,453 (GRCm39)	missense	probably damaging	1.00
R9245:Elp1	UTSW	4	56,771,003 (GRCm39)	missense	probably benign	0.01
R9562:Elp1	UTSW	4	56,772,521 (GRCm39)	missense	probably benign	0.00
R9565:Elp1	UTSW	4	56,772,521 (GRCm39)	missense	probably benign	0.00
R9568:Elp1	UTSW	4	56,786,711 (GRCm39)	missense	probably damaging	1.00
Z1176:Elp1	UTSW	4	56,790,146 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGCTGCATGAATCCAGG -3'
(R):5'- TAGTGTGGGGAAGACAGTCC -3'

Sequencing Primer
(F):5'- GGCTGCATGAATCCAGGACAAAAC -3'
(R):5'- TTAGTGAAAACTGGGTTGACATG -3'

Posted On

2018-06-22