Incidental Mutation 'R6608:Adamts18'
ID 526425
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms E130314N14Rik
MMRRC Submission 044731-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R6608 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 114423758-114575370 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114501911 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 317 (Y317N)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
AlphaFold Q4VC17
Predicted Effect probably damaging
Transcript: ENSMUST00000093113
AA Change: Y317N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: Y317N

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212527
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213078
Meta Mutation Damage Score 0.9570 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,770,555 (GRCm39) T571A probably benign Het
Adgrg5 T C 8: 95,668,348 (GRCm39) F470S probably damaging Het
AK157302 T C 13: 21,679,794 (GRCm39) S107P probably damaging Het
Ankrd31 A G 13: 96,969,288 (GRCm39) Y975C probably damaging Het
Ankrd37 C T 8: 46,452,891 (GRCm39) probably benign Het
Aox1 T C 1: 58,096,705 (GRCm39) Y267H probably benign Het
Cdan1 A C 2: 120,557,161 (GRCm39) I555R possibly damaging Het
Clns1a A G 7: 97,365,675 (GRCm39) T226A probably benign Het
Col18a1 C T 10: 76,948,628 (GRCm39) probably benign Het
Col5a3 C A 9: 20,685,315 (GRCm39) V1454L unknown Het
Coq6 G A 12: 84,418,922 (GRCm39) V309I probably benign Het
Decr2 C T 17: 26,302,858 (GRCm39) V173M probably benign Het
Dmgdh G A 13: 93,843,252 (GRCm39) G363S possibly damaging Het
Dnah7a A T 1: 53,564,277 (GRCm39) D1927E probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Epm2a T C 10: 11,266,731 (GRCm39) probably null Het
Gm1979 T A 5: 26,206,094 (GRCm39) H162L probably benign Het
Irag1 A T 7: 110,487,758 (GRCm39) S486T probably damaging Het
Knl1 A G 2: 118,917,093 (GRCm39) N1759D probably damaging Het
Man1b1 T A 2: 25,233,263 (GRCm39) V212E probably damaging Het
Marf1 A G 16: 13,950,578 (GRCm39) L936S probably damaging Het
Mki67 G A 7: 135,300,090 (GRCm39) T1648I probably benign Het
Or2n1c T C 17: 38,519,370 (GRCm39) V78A probably damaging Het
Or3a1b T C 11: 74,012,454 (GRCm39) V113A probably benign Het
Or5d40 A G 2: 88,016,049 (GRCm39) Y276C possibly damaging Het
Or6n2 A G 1: 173,897,295 (GRCm39) M144V probably benign Het
Parp11 A G 6: 127,454,811 (GRCm39) I110V possibly damaging Het
Pcdhb5 A G 18: 37,454,876 (GRCm39) T419A probably damaging Het
Pitpnm1 A G 19: 4,160,875 (GRCm39) D838G probably damaging Het
Rbm26 T A 14: 105,389,934 (GRCm39) N230I probably damaging Het
Rnf20 C T 4: 49,650,051 (GRCm39) S540F probably benign Het
Rsad1 T C 11: 94,433,435 (GRCm39) D417G probably damaging Het
Serpina3c A T 12: 104,115,883 (GRCm39) N220K probably benign Het
Slc6a19 A G 13: 73,832,091 (GRCm39) L495P probably damaging Het
Stard7 A T 2: 127,132,715 (GRCm39) K194N probably damaging Het
Tinagl1 A G 4: 130,066,782 (GRCm39) M105T probably benign Het
Ttn G A 2: 76,579,673 (GRCm39) T23740M probably damaging Het
Tyk2 G T 9: 21,019,312 (GRCm39) Q1014K probably benign Het
Usp10 C T 8: 120,675,161 (GRCm39) R461W probably benign Het
Wsb1 C T 11: 79,131,188 (GRCm39) E403K probably benign Het
Ylpm1 C G 12: 85,062,051 (GRCm39) P651A unknown Het
Zp1 C T 19: 10,896,344 (GRCm39) C127Y possibly damaging Het
Zzef1 T A 11: 72,803,652 (GRCm39) F2466L probably damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 114,501,575 (GRCm39) missense probably damaging 1.00
IGL01548:Adamts18 APN 8 114,490,931 (GRCm39) missense probably damaging 1.00
IGL01556:Adamts18 APN 8 114,571,741 (GRCm39) missense probably benign 0.01
IGL01833:Adamts18 APN 8 114,469,728 (GRCm39) missense probably benign 0.10
IGL02187:Adamts18 APN 8 114,439,826 (GRCm39) missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 114,425,704 (GRCm39) missense probably damaging 1.00
IGL02756:Adamts18 APN 8 114,440,976 (GRCm39) splice site probably benign
IGL03188:Adamts18 APN 8 114,425,656 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts18 APN 8 114,490,929 (GRCm39) nonsense probably null
G1patch:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R0119:Adamts18 UTSW 8 114,501,585 (GRCm39) missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 114,469,749 (GRCm39) missense probably damaging 1.00
R0410:Adamts18 UTSW 8 114,440,990 (GRCm39) nonsense probably null
R0480:Adamts18 UTSW 8 114,465,450 (GRCm39) missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 114,465,401 (GRCm39) splice site probably null
R0924:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R0930:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R1333:Adamts18 UTSW 8 114,431,805 (GRCm39) splice site probably benign
R1441:Adamts18 UTSW 8 114,481,194 (GRCm39) critical splice donor site probably null
R2082:Adamts18 UTSW 8 114,501,965 (GRCm39) missense probably damaging 1.00
R2146:Adamts18 UTSW 8 114,571,635 (GRCm39) missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 114,431,893 (GRCm39) missense probably benign 0.36
R3148:Adamts18 UTSW 8 114,465,490 (GRCm39) missense probably damaging 1.00
R3963:Adamts18 UTSW 8 114,504,443 (GRCm39) missense probably benign 0.00
R4056:Adamts18 UTSW 8 114,464,212 (GRCm39) nonsense probably null
R4486:Adamts18 UTSW 8 114,439,825 (GRCm39) missense probably benign 0.00
R4608:Adamts18 UTSW 8 114,464,245 (GRCm39) missense probably damaging 1.00
R4624:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4626:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4627:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4628:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4629:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4710:Adamts18 UTSW 8 114,433,558 (GRCm39) missense probably damaging 0.98
R4959:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4973:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4976:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5119:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5141:Adamts18 UTSW 8 114,501,902 (GRCm39) missense probably damaging 1.00
R5422:Adamts18 UTSW 8 114,425,606 (GRCm39) missense probably benign 0.06
R5587:Adamts18 UTSW 8 114,501,992 (GRCm39) nonsense probably null
R5868:Adamts18 UTSW 8 114,504,380 (GRCm39) missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 114,499,709 (GRCm39) missense probably damaging 1.00
R5906:Adamts18 UTSW 8 114,436,251 (GRCm39) missense probably benign 0.00
R5942:Adamts18 UTSW 8 114,504,380 (GRCm39) missense probably benign 0.01
R6006:Adamts18 UTSW 8 114,433,606 (GRCm39) missense probably damaging 1.00
R6725:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R7002:Adamts18 UTSW 8 114,501,922 (GRCm39) missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 114,501,896 (GRCm39) missense probably damaging 0.99
R7292:Adamts18 UTSW 8 114,436,277 (GRCm39) missense probably benign 0.00
R7411:Adamts18 UTSW 8 114,504,362 (GRCm39) missense probably damaging 0.99
R7685:Adamts18 UTSW 8 114,439,855 (GRCm39) missense probably damaging 1.00
R7737:Adamts18 UTSW 8 114,463,566 (GRCm39) splice site probably null
R7860:Adamts18 UTSW 8 114,501,908 (GRCm39) missense probably damaging 1.00
R7936:Adamts18 UTSW 8 114,493,760 (GRCm39) missense probably damaging 1.00
R8197:Adamts18 UTSW 8 114,481,227 (GRCm39) missense probably damaging 1.00
R8363:Adamts18 UTSW 8 114,493,795 (GRCm39) missense probably damaging 1.00
R8759:Adamts18 UTSW 8 114,433,624 (GRCm39) missense probably damaging 1.00
R8934:Adamts18 UTSW 8 114,463,510 (GRCm39) missense possibly damaging 0.90
R9405:Adamts18 UTSW 8 114,430,030 (GRCm39) missense probably damaging 1.00
R9422:Adamts18 UTSW 8 114,501,910 (GRCm39) missense probably damaging 1.00
R9450:Adamts18 UTSW 8 114,490,942 (GRCm39) missense probably benign 0.10
R9475:Adamts18 UTSW 8 114,504,570 (GRCm39) missense possibly damaging 0.93
Z1088:Adamts18 UTSW 8 114,502,072 (GRCm39) missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 114,469,800 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGTGTAGGTTTCAATCTTACCAGAC -3'
(R):5'- AGCCTATGTCACCCAGATTTTG -3'

Sequencing Primer
(F):5'- GGTTTCAATCTTACCAGACTCAAAAG -3'
(R):5'- GTCTCTCACAGATGCCCCCAAG -3'
Posted On 2018-06-25