Incidental Mutation 'R6608:Ankrd31'
ID526435
Institutional Source Beutler Lab
Gene Symbol Ankrd31
Ensembl Gene ENSMUSG00000109561
Gene Nameankyrin repeat domain 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location96748272-96910039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96832780 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 975 (Y975C)
Ref Sequence ENSEMBL: ENSMUSP00000146720 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207464
AA Change: Y825C
Predicted Effect probably damaging
Transcript: ENSMUST00000208758
AA Change: Y975C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Ankrd31
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6001:Ankrd31 UTSW 13 96826209 missense probably damaging 1.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6273:Ankrd31 UTSW 13 96851673 missense possibly damaging 0.61
R6291:Ankrd31 UTSW 13 96878238 missense possibly damaging 0.72
R6387:Ankrd31 UTSW 13 96830573 missense probably damaging 0.99
R6680:Ankrd31 UTSW 13 96830609 critical splice donor site probably null
R6738:Ankrd31 UTSW 13 96904127 missense possibly damaging 0.79
R6860:Ankrd31 UTSW 13 96831586 missense probably benign 0.01
R6988:Ankrd31 UTSW 13 96878249 missense probably damaging 1.00
R7305:Ankrd31 UTSW 13 96878971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTCCTTTAGTAAATCAGGCTGG -3'
(R):5'- AATCATGGCTCAGGTGATGCC -3'

Sequencing Primer
(F):5'- AATCAGGCTGGTATACATAGTTTGG -3'
(R):5'- TCAGGTGATGCCCTCATGC -3'
Posted On2018-06-25