Incidental Mutation 'R6243:Atg16l2'
List |< first << previous [record 69 of 958] next >> last >|
ID526467
Institutional Source Beutler Lab
Gene Symbol Atg16l2
Ensembl Gene ENSMUSG00000047767
Gene Nameautophagy related 16-like 2 (S. cerevisiae)
Synonyms2410118P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6243 (G1)
Quality Score157.009
Status Validated
Chromosome7
Chromosomal Location101263034-101302251 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 101292329 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamic Acid at position 404 (*404E)
Ref Sequence ENSEMBL: ENSMUSP00000117029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120267] [ENSMUST00000122116] [ENSMUST00000139609] [ENSMUST00000140553] [ENSMUST00000143630] [ENSMUST00000207740]
Predicted Effect probably benign
Transcript: ENSMUST00000120267
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122116
SMART Domains Protein: ENSMUSP00000113320
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 5.4e-14 PFAM
WD40 308 347 1.13e-7 SMART
WD40 352 391 6.79e-2 SMART
WD40 394 433 1.08e-4 SMART
WD40 436 472 2.97e0 SMART
WD40 475 513 1.61e-3 SMART
WD40 518 559 1.66e0 SMART
WD40 562 602 2.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134531
Predicted Effect probably null
Transcript: ENSMUST00000139609
AA Change: *404E
SMART Domains Protein: ENSMUSP00000117387
Gene: ENSMUSG00000047767
AA Change: *404E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140059
SMART Domains Protein: ENSMUSP00000119734
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
WD40 76 115 1.13e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140553
SMART Domains Protein: ENSMUSP00000116414
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000143630
AA Change: *404E
SMART Domains Protein: ENSMUSP00000117029
Gene: ENSMUSG00000047767
AA Change: *404E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153327
Predicted Effect probably benign
Transcript: ENSMUST00000207740
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,314,301 S331P probably damaging Het
Akap9 T G 5: 4,065,000 probably null Het
Ankef1 A G 2: 136,537,157 E9G probably damaging Het
Ap1g2 T C 14: 55,099,073 E788G probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asrgl1 A T 19: 9,116,504 I220K probably damaging Het
Atp4a T C 7: 30,715,957 F334S possibly damaging Het
Atp6v0d1 T C 8: 105,565,863 E17G probably benign Het
Bcat2 T C 7: 45,588,267 V279A probably benign Het
Birc6 T G 17: 74,609,387 M459R probably damaging Het
Bsn T C 9: 108,107,561 Y3098C unknown Het
Btaf1 T A 19: 36,981,120 M679K probably benign Het
Col6a4 T C 9: 106,013,390 T1902A possibly damaging Het
Crhr1 G A 11: 104,173,914 C364Y probably damaging Het
Crmp1 T C 5: 37,288,944 L648P probably damaging Het
Cyfip1 T C 7: 55,900,529 Y671H probably damaging Het
Cyp2b13 C T 7: 26,061,619 P34S probably damaging Het
Dnajb6 T A 5: 29,781,133 V233E probably benign Het
Dnhd1 A T 7: 105,652,009 H191L probably damaging Het
Dsg3 T A 18: 20,539,724 D817E probably damaging Het
Dytn T C 1: 63,647,521 Q330R possibly damaging Het
Fads1 G T 19: 10,185,727 E123* probably null Het
Fchsd2 T C 7: 101,271,809 probably benign Het
Fmo9 T C 1: 166,667,369 E270G probably benign Het
Folr1 T A 7: 101,863,965 H41L probably damaging Het
Gm29776 T A 14: 54,695,759 R322S probably damaging Het
Gm7298 A G 6: 121,779,137 N985S possibly damaging Het
Gp1ba T C 11: 70,640,137 probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Igf2bp3 A T 6: 49,107,428 N285K possibly damaging Het
Lca5l G A 16: 96,178,912 T6I possibly damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mpeg1 A G 19: 12,462,240 H354R probably benign Het
Msh6 T A 17: 87,983,571 V195E possibly damaging Het
Mtfmt C T 9: 65,443,900 T243I probably benign Het
Myo1h T A 5: 114,362,147 I195K probably damaging Het
Nr1h5 T C 3: 102,949,064 K300E probably benign Het
Nuak2 T C 1: 132,332,367 S628P probably benign Het
Nup214 G T 2: 32,002,932 A721S possibly damaging Het
Olfr1148 A G 2: 87,833,041 M1V probably null Het
Olfr74 A G 2: 87,974,587 V26A probably benign Het
Pclo T C 5: 14,676,443 probably benign Het
Phf20 A G 2: 156,223,400 S12G probably benign Het
Pik3r5 T C 11: 68,492,000 Y289H probably damaging Het
Pld1 T C 3: 28,095,805 I717T probably damaging Het
Plxdc1 A G 11: 97,955,473 Y182H probably damaging Het
Ppid A G 3: 79,603,066 I354V probably benign Het
Prss2 T C 6: 41,524,453 V152A probably benign Het
Rab28 C T 5: 41,635,880 A141T probably benign Het
Rabgap1l C T 1: 160,645,307 probably null Het
Rabl6 T G 2: 25,585,403 S553R probably damaging Het
Rars A G 11: 35,826,547 F170S possibly damaging Het
Ror2 T A 13: 53,113,080 M440L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph4a A T 10: 33,909,143 Q350L probably damaging Het
Serpinb2 T C 1: 107,523,139 F204L probably damaging Het
Sertad4 T C 1: 192,850,949 probably null Het
Shisa3 C T 5: 67,611,143 P129S probably benign Het
Slc13a2 G A 11: 78,404,708 L111F probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Stab2 T A 10: 86,907,161 R1195W probably damaging Het
Syna C A 5: 134,560,114 probably benign Het
Thada A T 17: 84,436,602 D759E probably benign Het
Thoc5 A G 11: 4,919,753 Y385C possibly damaging Het
Thsd7a C T 6: 12,327,602 D1424N probably damaging Het
Thsd7b A T 1: 130,162,862 Q1204L probably benign Het
Tnfrsf8 T C 4: 145,303,101 N43S possibly damaging Het
Trim66 T C 7: 109,460,274 K921R probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ugt2a2 T G 5: 87,462,959 K339N probably benign Het
Vmn2r8 T C 5: 108,799,345 T514A probably benign Het
Wrn A T 8: 33,284,654 M652K possibly damaging Het
Yme1l1 A T 2: 23,193,172 Y550F probably benign Het
Zfp995 G A 17: 21,880,288 P322S probably damaging Het
Other mutations in Atg16l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Atg16l2 APN 7 101300160 missense probably damaging 1.00
IGL00402:Atg16l2 APN 7 101296153 missense probably benign 0.00
IGL00662:Atg16l2 APN 7 101289896 missense probably benign 0.00
IGL00905:Atg16l2 APN 7 101300166 missense probably damaging 1.00
IGL01644:Atg16l2 APN 7 101297217 makesense probably null
IGL02839:Atg16l2 APN 7 101293397 missense probably damaging 1.00
R0316:Atg16l2 UTSW 7 101293396 missense probably damaging 1.00
R0638:Atg16l2 UTSW 7 101300110 critical splice donor site probably null
R0683:Atg16l2 UTSW 7 101290384 missense probably damaging 1.00
R1436:Atg16l2 UTSW 7 101291550 missense probably damaging 1.00
R1592:Atg16l2 UTSW 7 101291986 missense probably damaging 1.00
R1623:Atg16l2 UTSW 7 101289906 missense probably benign 0.01
R2002:Atg16l2 UTSW 7 101294920 missense possibly damaging 0.62
R2090:Atg16l2 UTSW 7 101293368 splice site probably null
R2103:Atg16l2 UTSW 7 101290361 critical splice donor site probably null
R2349:Atg16l2 UTSW 7 101296539 missense probably damaging 0.96
R4738:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4739:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4740:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R5704:Atg16l2 UTSW 7 101300211 missense probably damaging 1.00
R6257:Atg16l2 UTSW 7 101301895 splice site probably null
R6613:Atg16l2 UTSW 7 101290581 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCTGCCAAAACCTGGG -3'
(R):5'- AGGCTAAGAATCTCATTCCTGG -3'

Sequencing Primer
(F):5'- CAAAACCTGGGAGCCCTG -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2018-06-30