Incidental Mutation 'R6653:Hephl1'
ID526512
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Namehephaestin-like 1
SynonymsLOC244698, zyklopen, Zp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location15051841-15112108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15081964 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 525 (V525I)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
Predicted Effect probably damaging
Transcript: ENSMUST00000159985
AA Change: V525I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: V525I

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1833:Hephl1 UTSW 9 15076928 missense probably damaging 0.99
R1908:Hephl1 UTSW 9 15074124 nonsense probably null
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R1986:Hephl1 UTSW 9 15054552 missense probably damaging 1.00
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGCCCTGGAAAGAGTGTG -3'
(R):5'- TGAAGCCCAGGGAATCTCTG -3'

Sequencing Primer
(F):5'- TGGTGACATTGGTGGCCCAC -3'
(R):5'- TTTGTGAGGAAAAACGGCCTTC -3'
Posted On2018-07-23