Incidental Mutation 'R6653:Cts7'
ID526524
Institutional Source Beutler Lab
Gene Symbol Cts7
Ensembl Gene ENSMUSG00000021440
Gene Namecathepsin 7
SynonymsEpcs24, Epcs71, CTS1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61352461-61358197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61355003 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 237 (L237Q)
Ref Sequence ENSEMBL: ENSMUSP00000153603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021892] [ENSMUST00000224773] [ENSMUST00000224986] [ENSMUST00000225321]
Predicted Effect probably damaging
Transcript: ENSMUST00000021892
AA Change: L237Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021892
Gene: ENSMUSG00000021440
AA Change: L237Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 2.02e-15 SMART
Pept_C1 112 330 6.25e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224773
Predicted Effect probably damaging
Transcript: ENSMUST00000224986
AA Change: L237Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225321
AA Change: L237Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Cts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Cts7 APN 13 61356909 critical splice donor site probably null
IGL01954:Cts7 APN 13 61352823 missense probably benign 0.06
IGL01973:Cts7 APN 13 61355600 missense probably benign 0.02
IGL02098:Cts7 APN 13 61356529 missense probably damaging 1.00
IGL02716:Cts7 APN 13 61356608 missense probably benign 0.01
IGL02903:Cts7 APN 13 61356626 splice site probably benign
IGL03351:Cts7 APN 13 61356603 missense probably damaging 1.00
PIT4305001:Cts7 UTSW 13 61356572 missense probably damaging 1.00
R0691:Cts7 UTSW 13 61355734 missense probably damaging 1.00
R1168:Cts7 UTSW 13 61353817 missense probably damaging 0.99
R1711:Cts7 UTSW 13 61352810 missense probably damaging 1.00
R2352:Cts7 UTSW 13 61352772 nonsense probably null
R2442:Cts7 UTSW 13 61355617 nonsense probably null
R3817:Cts7 UTSW 13 61356536 missense probably damaging 0.98
R5513:Cts7 UTSW 13 61355584 missense possibly damaging 0.70
R5870:Cts7 UTSW 13 61355731 missense probably damaging 0.99
R6286:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6288:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6479:Cts7 UTSW 13 61355641 missense probably benign 0.00
R6721:Cts7 UTSW 13 61356294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGTCTCATAGAAGCAATGTAC -3'
(R):5'- ATATTTCACTGCCGAGGAAGC -3'

Sequencing Primer
(F):5'- GCAATGTACTTAATGCATGGATAAGC -3'
(R):5'- ACAGACATGGGGGTGTTCC -3'
Posted On2018-07-23