Incidental Mutation 'R6654:Nlrc4'
ID526575
Institutional Source Beutler Lab
Gene Symbol Nlrc4
Ensembl Gene ENSMUSG00000039193
Gene NameNLR family, CARD domain containing 4
SynonymsCard12, Ipaf, 9530011P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location74426295-74459108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74445528 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 620 (A620V)
Ref Sequence ENSEMBL: ENSMUSP00000059637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052124]
PDB Structure
Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052124
AA Change: A620V

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: A620V

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Nlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nlrc4 APN 17 74446534 missense probably benign 0.02
IGL00427:Nlrc4 APN 17 74447092 missense probably benign
IGL00823:Nlrc4 APN 17 74447990 missense probably benign 0.01
IGL01404:Nlrc4 APN 17 74445711 missense probably damaging 1.00
IGL02178:Nlrc4 APN 17 74446843 missense probably damaging 1.00
IGL02266:Nlrc4 APN 17 74446167 missense possibly damaging 0.72
IGL03342:Nlrc4 APN 17 74445318 missense probably damaging 1.00
inwood UTSW 17 74445630 missense probably damaging 1.00
PIT4305001:Nlrc4 UTSW 17 74446309 missense probably damaging 0.99
PIT4466001:Nlrc4 UTSW 17 74427119 missense probably benign 0.01
R0077:Nlrc4 UTSW 17 74446831 missense probably damaging 1.00
R0398:Nlrc4 UTSW 17 74445920 missense probably damaging 0.99
R0639:Nlrc4 UTSW 17 74426963 missense probably benign 0.16
R1498:Nlrc4 UTSW 17 74446413 missense probably benign 0.43
R1565:Nlrc4 UTSW 17 74441931 missense probably benign 0.00
R1624:Nlrc4 UTSW 17 74445189 missense possibly damaging 0.55
R1666:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1668:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1690:Nlrc4 UTSW 17 74437523 nonsense probably null
R1723:Nlrc4 UTSW 17 74441908 missense probably damaging 1.00
R1988:Nlrc4 UTSW 17 74426943 missense probably benign 0.09
R1992:Nlrc4 UTSW 17 74445633 missense probably benign 0.04
R2141:Nlrc4 UTSW 17 74447951 splice site probably benign
R2256:Nlrc4 UTSW 17 74445630 missense probably damaging 1.00
R2897:Nlrc4 UTSW 17 74448045 missense probably benign
R3117:Nlrc4 UTSW 17 74436068 missense probably benign 0.00
R3861:Nlrc4 UTSW 17 74445621 missense probably benign 0.00
R4093:Nlrc4 UTSW 17 74445958 missense probably benign 0.20
R4212:Nlrc4 UTSW 17 74447115 missense possibly damaging 0.66
R4627:Nlrc4 UTSW 17 74446628 missense probably damaging 1.00
R4859:Nlrc4 UTSW 17 74436037 missense probably damaging 0.97
R4968:Nlrc4 UTSW 17 74446941 missense probably benign 0.20
R5133:Nlrc4 UTSW 17 74446717 missense possibly damaging 0.91
R5379:Nlrc4 UTSW 17 74448083 nonsense probably null
R6045:Nlrc4 UTSW 17 74446959 missense probably damaging 0.98
R6712:Nlrc4 UTSW 17 74446836 missense probably damaging 0.96
R6976:Nlrc4 UTSW 17 74445939 missense probably damaging 1.00
R7030:Nlrc4 UTSW 17 74446006 missense probably damaging 1.00
R7153:Nlrc4 UTSW 17 74447103 missense possibly damaging 0.84
R7190:Nlrc4 UTSW 17 74445203 missense probably damaging 1.00
R7398:Nlrc4 UTSW 17 74446542 missense probably damaging 1.00
R7417:Nlrc4 UTSW 17 74446488 missense probably benign 0.18
R7468:Nlrc4 UTSW 17 74445512 missense probably benign 0.00
X0026:Nlrc4 UTSW 17 74446643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGAGCTGAATATCTTCCC -3'
(R):5'- CGTAGAGTGTGGCATCAATTTGTTC -3'

Sequencing Primer
(F):5'- TCCTGCTTCCAGTTGAAG -3'
(R):5'- GGCATCAATTTGTTCTCAGAGAG -3'
Posted On2018-07-23