Incidental Mutation 'R6655:Nbn'
ID526583
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6655 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15981696 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 596 (E596G)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: E596G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: E596G

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149069
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,340 L530P possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Alg3 T A 16: 20,609,026 Y12F probably benign Het
Arhgef28 A G 13: 97,899,655 Y1699H probably damaging Het
Cd109 A G 9: 78,684,938 D778G probably benign Het
Dlc1 A G 8: 36,572,716 V1430A probably damaging Het
Dscaml1 G A 9: 45,746,937 V1669I probably benign Het
Fkbp8 A G 8: 70,532,670 Y278C probably damaging Het
Gm13178 T A 4: 144,705,245 D130V probably damaging Het
Gm5160 T C 18: 14,425,130 F88S possibly damaging Het
Kcnh1 A G 1: 192,413,083 N483S possibly damaging Het
Lrp2 A G 2: 69,453,858 S3859P probably benign Het
Myof T C 19: 37,934,791 N1351S probably damaging Het
Neurl4 T C 11: 69,910,916 probably null Het
Nol8 T C 13: 49,654,392 L10P probably damaging Het
Olfr325 T A 11: 58,581,210 M122K probably damaging Het
Olfr806 T C 10: 129,738,087 T277A possibly damaging Het
Pex26 T C 6: 121,190,211 probably benign Het
Rab3gap2 T C 1: 185,250,011 M420T probably damaging Het
Samd9l C A 6: 3,377,247 V5L probably benign Het
Sec22b T A 3: 97,914,648 probably null Het
Shank1 A G 7: 44,327,220 I581V unknown Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Ttll9 T C 2: 153,000,303 probably null Het
Veph1 T A 3: 66,205,613 I257F possibly damaging Het
Vmn1r222 A C 13: 23,232,716 I109S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wnt16 T C 6: 22,290,966 V131A probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.06
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTGACAGGAAACCACTTC -3'
(R):5'- TGTGTACAGTAGGTCACCTGGG -3'

Sequencing Primer
(F):5'- TTCCCACAGAAACTCTTAGACCCAG -3'
(R):5'- TGCAGTCACAGCACTCATG -3'
Posted On2018-07-23