Mutagenetix > Incidental Mutation

Incidental Mutation 'R6655:Samd9l'

526585

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

044776-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3372257-3399571 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 3377247 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 5 (V5L)

Ref Sequence

ENSEMBL: ENSMUSP00000144632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000120087
AA Change: V5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: V5L

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638
AA Change: V5L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735
AA Change: V5L

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AAdacl4fm3	T	A	4: 144,431,815 (GRCm39)	D130V	probably damaging	Het
Akr1b1	C	T	6: 34,286,939 (GRCm39)	V206M	possibly damaging	Het
Alg3	T	A	16: 20,427,776 (GRCm39)	Y12F	probably benign	Het
Arhgef28	A	G	13: 98,036,163 (GRCm39)	Y1699H	probably damaging	Het
Cd109	A	G	9: 78,592,220 (GRCm39)	D778G	probably benign	Het
Dlc1	A	G	8: 37,039,870 (GRCm39)	V1430A	probably damaging	Het
Dscaml1	G	A	9: 45,658,235 (GRCm39)	V1669I	probably benign	Het
Fkbp8	A	G	8: 70,985,320 (GRCm39)	Y278C	probably damaging	Het
Gm5160	T	C	18: 14,558,187 (GRCm39)	F88S	possibly damaging	Het
Kcnh1	A	G	1: 192,095,391 (GRCm39)	N483S	possibly damaging	Het
Lrp2	A	G	2: 69,284,202 (GRCm39)	S3859P	probably benign	Het
Myof	T	C	19: 37,923,239 (GRCm39)	N1351S	probably damaging	Het
Nbn	A	G	4: 15,981,696 (GRCm39)	E596G	probably damaging	Het
Neurl4	T	C	11: 69,801,742 (GRCm39)		probably null	Het
Nol8	T	C	13: 49,807,868 (GRCm39)	L10P	probably damaging	Het
Or2t46	T	A	11: 58,472,036 (GRCm39)	M122K	probably damaging	Het
Or6c213	T	C	10: 129,573,956 (GRCm39)	T277A	possibly damaging	Het
Pex26	T	C	6: 121,167,170 (GRCm39)		probably benign	Het
Rab3gap2	T	C	1: 184,982,208 (GRCm39)	M420T	probably damaging	Het
Sec22b	T	A	3: 97,821,964 (GRCm39)		probably null	Het
Shank1	A	G	7: 43,976,644 (GRCm39)	I581V	unknown	Het
Ssbp2	C	T	13: 91,812,268 (GRCm39)	P105L	probably damaging	Het
Ttll9	T	C	2: 152,842,223 (GRCm39)		probably null	Het
Veph1	T	A	3: 66,113,034 (GRCm39)	I257F	possibly damaging	Het
Vmn1r222	A	C	13: 23,416,886 (GRCm39)	I109S	probably damaging	Het
Vmn2r111	T	C	17: 22,778,032 (GRCm39)	N549S	possibly damaging	Het
Wnt16	T	C	6: 22,290,965 (GRCm39)	V131A	probably damaging	Het
Zfp747l1	A	G	7: 126,983,512 (GRCm39)	L530P	possibly damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3,376,779 (GRCm39)	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3,374,594 (GRCm39)	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3,375,863 (GRCm39)	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3,376,259 (GRCm39)	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3,375,566 (GRCm39)	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3,376,734 (GRCm39)	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3,375,120 (GRCm39)	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3,373,864 (GRCm39)	nonsense	probably null
IGL02063:Samd9l	APN	6	3,372,992 (GRCm39)	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3,376,575 (GRCm39)	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3,374,105 (GRCm39)	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3,374,246 (GRCm39)	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3,376,197 (GRCm39)	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3,374,798 (GRCm39)	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3,375,760 (GRCm39)	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3,376,026 (GRCm39)	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3,374,980 (GRCm39)	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3,375,348 (GRCm39)	nonsense	probably null
IGL03160:Samd9l	APN	6	3,374,894 (GRCm39)	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3,375,314 (GRCm39)	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3,376,208 (GRCm39)	missense	probably damaging	0.99
boston_lager	UTSW	6	3,375,761 (GRCm39)	missense	probably benign	0.12
ipa	UTSW	6	3,376,347 (GRCm39)	missense	probably damaging	1.00
Paine	UTSW	6	3,372,716 (GRCm39)	missense	probably damaging	0.99
samad	UTSW	6	3,374,032 (GRCm39)	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3,376,023 (GRCm39)	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3,374,946 (GRCm39)	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3,376,031 (GRCm39)	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3,375,107 (GRCm39)	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3,377,264 (GRCm39)	start gained	probably benign
R0398:Samd9l	UTSW	6	3,374,502 (GRCm39)	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3,372,725 (GRCm39)	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3,372,725 (GRCm39)	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3,377,064 (GRCm39)	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3,374,267 (GRCm39)	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3,376,939 (GRCm39)	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3,376,113 (GRCm39)	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3,373,947 (GRCm39)	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3,376,369 (GRCm39)	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3,375,426 (GRCm39)	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3,375,761 (GRCm39)	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3,373,771 (GRCm39)	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3,373,126 (GRCm39)	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3,373,401 (GRCm39)	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3,375,264 (GRCm39)	nonsense	probably null
R1829:Samd9l	UTSW	6	3,375,107 (GRCm39)	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3,376,269 (GRCm39)	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3,372,945 (GRCm39)	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3,376,910 (GRCm39)	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3,374,032 (GRCm39)	nonsense	probably null
R3903:Samd9l	UTSW	6	3,376,830 (GRCm39)	nonsense	probably null
R3904:Samd9l	UTSW	6	3,376,830 (GRCm39)	nonsense	probably null
R3945:Samd9l	UTSW	6	3,377,029 (GRCm39)	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3,376,887 (GRCm39)	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3,373,937 (GRCm39)	frame shift	probably null
R4602:Samd9l	UTSW	6	3,373,935 (GRCm39)	missense	probably damaging	1.00
R4618:Samd9l	UTSW	6	3,376,347 (GRCm39)	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3,375,504 (GRCm39)	nonsense	probably null
R4762:Samd9l	UTSW	6	3,375,623 (GRCm39)	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3,372,863 (GRCm39)	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3,375,621 (GRCm39)	nonsense	probably null
R5026:Samd9l	UTSW	6	3,375,284 (GRCm39)	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3,374,157 (GRCm39)	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3,374,548 (GRCm39)	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3,376,156 (GRCm39)	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3,376,739 (GRCm39)	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3,373,898 (GRCm39)	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3,373,291 (GRCm39)	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3,376,754 (GRCm39)	missense	probably benign
R5881:Samd9l	UTSW	6	3,372,716 (GRCm39)	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3,376,460 (GRCm39)	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3,377,252 (GRCm39)	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3,376,686 (GRCm39)	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3,375,383 (GRCm39)	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3,376,361 (GRCm39)	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3,376,896 (GRCm39)	missense	probably benign
R6601:Samd9l	UTSW	6	3,377,229 (GRCm39)	missense	possibly damaging	0.74
R6803:Samd9l	UTSW	6	3,375,446 (GRCm39)	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3,374,750 (GRCm39)	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3,375,387 (GRCm39)	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3,376,313 (GRCm39)	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3,372,716 (GRCm39)	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3,375,856 (GRCm39)	nonsense	probably null
R7250:Samd9l	UTSW	6	3,374,201 (GRCm39)	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3,372,600 (GRCm39)	nonsense	probably null
R7351:Samd9l	UTSW	6	3,374,157 (GRCm39)	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3,374,408 (GRCm39)	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3,376,754 (GRCm39)	missense	probably benign
R7667:Samd9l	UTSW	6	3,375,975 (GRCm39)	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3,373,646 (GRCm39)	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3,376,469 (GRCm39)	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3,372,569 (GRCm39)	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3,374,793 (GRCm39)	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3,374,749 (GRCm39)	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3,373,034 (GRCm39)	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3,375,549 (GRCm39)	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3,373,843 (GRCm39)	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3,377,064 (GRCm39)	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3,374,221 (GRCm39)	nonsense	probably null
R8806:Samd9l	UTSW	6	3,376,665 (GRCm39)	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3,374,990 (GRCm39)	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3,374,577 (GRCm39)	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3,373,791 (GRCm39)	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3,373,493 (GRCm39)	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3,373,104 (GRCm39)	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3,376,856 (GRCm39)	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3,375,830 (GRCm39)	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3,372,621 (GRCm39)	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3,373,578 (GRCm39)	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3,377,087 (GRCm39)	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3,375,078 (GRCm39)	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3,375,854 (GRCm39)	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3,375,560 (GRCm39)	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3,374,477 (GRCm39)	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3,376,770 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTATCAGAAGTGCTGGACCCC -3'
(R):5'- CTGTGAAATGAGCAATACTTAGGGC -3'

Sequencing Primer
(F):5'- CTGGACCCCGTGGCAAG -3'
(R):5'- TAGGGCAATGTATAGAATGAATCCC -3'

Posted On

2018-07-23