Incidental Mutation 'R6655:Ssbp2'
ID526600
Institutional Source Beutler Lab
Gene Symbol Ssbp2
Ensembl Gene ENSMUSG00000003992
Gene Namesingle-stranded DNA binding protein 2
SynonymsHspc116, 1500004K09Rik, 2310079I02Rik, 9330163K02Rik, A830008M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6655 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location91460283-91703429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91664149 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 105 (P105L)
Ref Sequence ENSEMBL: ENSMUSP00000037115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004094] [ENSMUST00000042122] [ENSMUST00000231481]
Predicted Effect probably damaging
Transcript: ENSMUST00000004094
AA Change: P135L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004094
Gene: ENSMUSG00000003992
AA Change: P135L

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 83 125 5.9e-19 PFAM
Pfam:SSDP 123 338 5.3e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042122
AA Change: P105L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037115
Gene: ENSMUSG00000003992
AA Change: P105L

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 94 313 2.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156547
Predicted Effect probably damaging
Transcript: ENSMUST00000231481
AA Change: P135L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a protein complex that interacts with single-stranded DNA and is involved in the DNA damage response and maintenance of genome stability. The encoded protein may also play a role in telomere repair. A variant of this gene may be associated with survival in human glioblastoma patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice exhibit some perinatal lethality and premature death associated with increased incidence of lymphoma and carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,340 L530P possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Alg3 T A 16: 20,609,026 Y12F probably benign Het
Arhgef28 A G 13: 97,899,655 Y1699H probably damaging Het
Cd109 A G 9: 78,684,938 D778G probably benign Het
Dlc1 A G 8: 36,572,716 V1430A probably damaging Het
Dscaml1 G A 9: 45,746,937 V1669I probably benign Het
Fkbp8 A G 8: 70,532,670 Y278C probably damaging Het
Gm13178 T A 4: 144,705,245 D130V probably damaging Het
Gm5160 T C 18: 14,425,130 F88S possibly damaging Het
Kcnh1 A G 1: 192,413,083 N483S possibly damaging Het
Lrp2 A G 2: 69,453,858 S3859P probably benign Het
Myof T C 19: 37,934,791 N1351S probably damaging Het
Nbn A G 4: 15,981,696 E596G probably damaging Het
Neurl4 T C 11: 69,910,916 probably null Het
Nol8 T C 13: 49,654,392 L10P probably damaging Het
Olfr325 T A 11: 58,581,210 M122K probably damaging Het
Olfr806 T C 10: 129,738,087 T277A possibly damaging Het
Pex26 T C 6: 121,190,211 probably benign Het
Rab3gap2 T C 1: 185,250,011 M420T probably damaging Het
Samd9l C A 6: 3,377,247 V5L probably benign Het
Sec22b T A 3: 97,914,648 probably null Het
Shank1 A G 7: 44,327,220 I581V unknown Het
Ttll9 T C 2: 153,000,303 probably null Het
Veph1 T A 3: 66,205,613 I257F possibly damaging Het
Vmn1r222 A C 13: 23,232,716 I109S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wnt16 T C 6: 22,290,966 V131A probably damaging Het
Other mutations in Ssbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Ssbp2 APN 13 91669752 splice site probably benign
IGL02962:Ssbp2 APN 13 91642371 missense possibly damaging 0.84
IGL03201:Ssbp2 APN 13 91524601 missense probably damaging 1.00
R0190:Ssbp2 UTSW 13 91669710 missense probably damaging 1.00
R0277:Ssbp2 UTSW 13 91564596 splice site probably benign
R0329:Ssbp2 UTSW 13 91680579 splice site probably null
R0330:Ssbp2 UTSW 13 91680579 splice site probably null
R1551:Ssbp2 UTSW 13 91642392 critical splice donor site probably null
R1846:Ssbp2 UTSW 13 91664149 missense probably damaging 1.00
R1957:Ssbp2 UTSW 13 91664184 splice site probably benign
R3732:Ssbp2 UTSW 13 91524607 missense probably damaging 1.00
R3744:Ssbp2 UTSW 13 91680646 splice site probably benign
R4469:Ssbp2 UTSW 13 91694056 missense probably damaging 1.00
R4665:Ssbp2 UTSW 13 91539335 missense possibly damaging 0.48
R4724:Ssbp2 UTSW 13 91688814 missense possibly damaging 0.70
R5477:Ssbp2 UTSW 13 91664125 missense probably damaging 0.98
R6015:Ssbp2 UTSW 13 91669743 critical splice donor site probably null
R6332:Ssbp2 UTSW 13 91690908 missense probably benign 0.01
R6523:Ssbp2 UTSW 13 91693051 missense probably benign 0.09
R6548:Ssbp2 UTSW 13 91539351 missense possibly damaging 0.91
X0026:Ssbp2 UTSW 13 91669688 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CAGGATGACAATTTTCTTGGAAGC -3'
(R):5'- TTTCCCTGTTCCAACAAAACTTAGC -3'

Sequencing Primer
(F):5'- AAGCTTTTGTTCTGCTGGAAAC -3'
(R):5'- AGTCAGTCAGCACACAGTCTGG -3'
Posted On2018-07-23