Incidental Mutation 'R6655:Gm5160'
ID526604
Institutional Source Beutler Lab
Gene Symbol Gm5160
Ensembl Gene ENSMUSG00000055795
Gene Namepredicted gene 5160
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6655 (G1)
Quality Score147.008
Status Not validated
Chromosome18
Chromosomal Location14424868-14425311 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14425130 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 88 (F88S)
Ref Sequence ENSEMBL: ENSMUSP00000094334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069552
AA Change: F88S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094334
Gene: ENSMUSG00000055795
AA Change: F88S

DomainStartEndE-ValueType
Pfam:Pro_isomerase 7 146 6.9e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,340 L530P possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Alg3 T A 16: 20,609,026 Y12F probably benign Het
Arhgef28 A G 13: 97,899,655 Y1699H probably damaging Het
Cd109 A G 9: 78,684,938 D778G probably benign Het
Dlc1 A G 8: 36,572,716 V1430A probably damaging Het
Dscaml1 G A 9: 45,746,937 V1669I probably benign Het
Fkbp8 A G 8: 70,532,670 Y278C probably damaging Het
Gm13178 T A 4: 144,705,245 D130V probably damaging Het
Kcnh1 A G 1: 192,413,083 N483S possibly damaging Het
Lrp2 A G 2: 69,453,858 S3859P probably benign Het
Myof T C 19: 37,934,791 N1351S probably damaging Het
Nbn A G 4: 15,981,696 E596G probably damaging Het
Neurl4 T C 11: 69,910,916 probably null Het
Nol8 T C 13: 49,654,392 L10P probably damaging Het
Olfr325 T A 11: 58,581,210 M122K probably damaging Het
Olfr806 T C 10: 129,738,087 T277A possibly damaging Het
Pex26 T C 6: 121,190,211 probably benign Het
Rab3gap2 T C 1: 185,250,011 M420T probably damaging Het
Samd9l C A 6: 3,377,247 V5L probably benign Het
Sec22b T A 3: 97,914,648 probably null Het
Shank1 A G 7: 44,327,220 I581V unknown Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Ttll9 T C 2: 153,000,303 probably null Het
Veph1 T A 3: 66,205,613 I257F possibly damaging Het
Vmn1r222 A C 13: 23,232,716 I109S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wnt16 T C 6: 22,290,966 V131A probably damaging Het
Predicted Primers PCR Primer
(F):5'- CCAATGATGAGACCTCAGGC -3'
(R):5'- TCAGAGTCGGAAATGGTGATC -3'

Sequencing Primer
(F):5'- GAGCTGTTTGCAGACAAAGTTCC -3'
(R):5'- CAGAGTCGGAAATGGTGATCTTCTTG -3'
Posted On2018-07-23