Incidental Mutation 'R6656:Ehf'
ID526612
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Nameets homologous factor
Synonyms9030625L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R6656 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103263433-103303278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103283583 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 23 (N23S)
Ref Sequence ENSEMBL: ENSMUSP00000121103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788] [ENSMUST00000140503] [ENSMUST00000151265]
Predicted Effect probably damaging
Transcript: ENSMUST00000090475
AA Change: N12S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350
AA Change: N12S

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111174
AA Change: N12S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350
AA Change: N12S

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111176
AA Change: N12S

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350
AA Change: N12S

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125788
AA Change: N23S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350
AA Change: N23S

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128546
Predicted Effect possibly damaging
Transcript: ENSMUST00000140503
AA Change: N51S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114979
Gene: ENSMUSG00000012350
AA Change: N51S

DomainStartEndE-ValueType
SAM_PNT 70 154 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151265
AA Change: N12S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118275
Gene: ENSMUSG00000012350
AA Change: N12S

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
B3galnt2 C T 13: 13,975,576 A168V probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
Cyp2b19 C T 7: 26,766,855 T361I probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm10436 A T 12: 88,175,993 L285Q possibly damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Keg1 C T 19: 12,709,630 Q8* probably null Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Npas2 T G 1: 39,361,948 S798A unknown Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103266840 unclassified probably null
IGL01296:Ehf APN 2 103268155 splice site probably null
IGL02095:Ehf APN 2 103266991 missense probably damaging 1.00
R0399:Ehf UTSW 2 103266870 missense probably damaging 1.00
R1116:Ehf UTSW 2 103267009 missense probably damaging 1.00
R1728:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R1729:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R2240:Ehf UTSW 2 103274075 missense probably benign
R2287:Ehf UTSW 2 103267124 missense possibly damaging 0.89
R2397:Ehf UTSW 2 103276819 missense probably damaging 0.99
R4094:Ehf UTSW 2 103290750 intron probably benign
R4687:Ehf UTSW 2 103267126 missense probably damaging 1.00
R4930:Ehf UTSW 2 103266857 missense probably damaging 1.00
R5695:Ehf UTSW 2 103266779 missense probably damaging 1.00
R5925:Ehf UTSW 2 103266993 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGATTAGGCAAGACATTGGGTTC -3'
(R):5'- CTGAAAGGGCTGTGGCAATG -3'

Sequencing Primer
(F):5'- TTGGGTTCAATGATCAGGAGAC -3'
(R):5'- CTGTGGCAATGGGTGGAAG -3'
Posted On2018-07-23