Incidental Mutation 'R6656:Gm10436'
ID526633
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6656 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88175993 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 285 (L285Q)
Ref Sequence ENSEMBL: ENSMUSP00000152292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071580
AA Change: L480Q

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: L480Q

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220521
AA Change: L285Q

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably benign
Transcript: ENSMUST00000222081
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect probably benign
Transcript: ENSMUST00000222556
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
B3galnt2 C T 13: 13,975,576 A168V probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
Cyp2b19 C T 7: 26,766,855 T361I probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Ehf T C 2: 103,283,583 N23S probably damaging Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Keg1 C T 19: 12,709,630 Q8* probably null Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Npas2 T G 1: 39,361,948 S798A unknown Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1279:Gm10436 UTSW 12 88175880 missense probably benign 0.42
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R2412:Gm10436 UTSW 12 88177110 missense probably damaging 0.98
R3040:Gm10436 UTSW 12 88178348 missense probably benign 0.00
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5601:Gm10436 UTSW 12 88176047 missense probably damaging 1.00
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTTGATTCTTTCTACAGATGCAAC -3'
(R):5'- AGCCAATGTTCTCACCTCAG -3'

Sequencing Primer
(F):5'- TCACCAGCTCAGAGGAAGTTATTGAC -3'
(R):5'- CCTCAGAGAGGTCACTTTCTATG -3'
Posted On2018-07-23