Incidental Mutation 'R6659:Add1'
ID526755
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R6659 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34613295 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 250 (A250V)
Ref Sequence ENSEMBL: ENSMUSP00000109974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000135321] [ENSMUST00000201810]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001108
AA Change: A250V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106
AA Change: A250V

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000052836
AA Change: A250V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106
AA Change: A250V

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114335
AA Change: A250V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106
AA Change: A250V

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114338
AA Change: A250V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106
AA Change: A250V

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114340
AA Change: A250V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: A250V

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144226
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 31,131,315 D212G probably damaging Het
Atxn2 A G 5: 121,777,964 N411S probably benign Het
AW551984 T C 9: 39,589,099 T788A probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddx46 A G 13: 55,669,724 T721A probably damaging Het
Eif2b1 G A 5: 124,579,108 probably benign Het
Eif4g3 A G 4: 138,177,932 K1241E probably damaging Het
Engase T A 11: 118,481,316 Y145N probably benign Het
Fbrs C A 7: 127,487,919 A674D probably damaging Het
Gm4884 G A 7: 41,044,622 G672R probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iars2 T A 1: 185,288,076 I954F possibly damaging Het
Itgad A T 7: 128,185,948 I310F probably damaging Het
Kcnmb3 A G 3: 32,472,445 V199A possibly damaging Het
Kctd12 G T 14: 102,982,186 D85E probably damaging Het
Lama1 G A 17: 67,818,635 R2929H probably damaging Het
Lgmn T A 12: 102,402,692 Y176F probably benign Het
Lipo3 A G 19: 33,556,428 F335L possibly damaging Het
Map2k3 T C 11: 60,942,324 S46P probably benign Het
Megf8 C A 7: 25,358,734 H2144Q probably benign Het
Neb A T 2: 52,234,353 W3694R probably damaging Het
Nek10 A G 14: 14,861,684 E580G probably benign Het
Obscn G A 11: 59,039,009 P5930S probably damaging Het
Palld A G 8: 61,533,443 F621L probably benign Het
Pkn2 A T 3: 142,803,587 I732N probably damaging Het
Plpbp T A 8: 27,052,279 I214N possibly damaging Het
Ppp1r37 A G 7: 19,532,123 S573P probably benign Het
Prg4 C A 1: 150,460,681 C97F probably damaging Het
Prmt2 T C 10: 76,217,374 D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 L80F probably damaging Het
Reep1 T A 6: 71,773,195 F64I probably damaging Het
Srcap C A 7: 127,542,391 P1720Q probably damaging Het
Ssr1 A T 13: 37,987,690 F124I probably damaging Het
Tbx18 A G 9: 87,707,811 L358P probably damaging Het
Tfpt T C 7: 3,620,836 K71E probably benign Het
Tmem132a C A 19: 10,860,321 G542C probably damaging Het
Tmem135 C A 7: 89,307,163 L81F probably benign Het
Tmem135 A T 7: 89,307,164 L81* probably null Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Washc5 A G 15: 59,340,890 probably null Het
Zfp24 T C 18: 24,017,334 E173G possibly damaging Het
Zgrf1 T C 3: 127,616,506 I1814T probably damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCAGAATCCCAGTCATGC -3'
(R):5'- TTCCAGGCTCTACAACTGAATACC -3'

Sequencing Primer
(F):5'- CTTCTGTCAGGGCCTGGAAG -3'
(R):5'- GCTCTACAACTGAATACCACAAGATG -3'
Posted On2018-07-23