Incidental Mutation 'R6659:Tbx18'
ID 526772
Institutional Source Beutler Lab
Gene Symbol Tbx18
Ensembl Gene ENSMUSG00000032419
Gene Name T-box18
Synonyms 2810012F10Rik, 2810404D13Rik
MMRRC Submission 044779-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6659 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 87584853-87613313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87589864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 358 (L358P)
Ref Sequence ENSEMBL: ENSMUSP00000034991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034991]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034991
AA Change: L358P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: L358P

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 113 132 N/A INTRINSIC
TBOX 144 341 8.7e-127 SMART
low complexity region 461 476 N/A INTRINSIC
low complexity region 555 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 T C 16: 30,950,133 (GRCm39) D212G probably damaging Het
Add1 C T 5: 34,770,639 (GRCm39) A250V possibly damaging Het
Atxn2 A G 5: 121,916,027 (GRCm39) N411S probably benign Het
AW551984 T C 9: 39,500,395 (GRCm39) T788A probably benign Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Ddx46 A G 13: 55,817,537 (GRCm39) T721A probably damaging Het
Eif2b1 G A 5: 124,717,171 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,905,243 (GRCm39) K1241E probably damaging Het
Engase T A 11: 118,372,142 (GRCm39) Y145N probably benign Het
Fbrs C A 7: 127,087,091 (GRCm39) A674D probably damaging Het
Gm4884 G A 7: 40,694,046 (GRCm39) G672R probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Iars2 T A 1: 185,020,273 (GRCm39) I954F possibly damaging Het
Itgad A T 7: 127,785,120 (GRCm39) I310F probably damaging Het
Kcnmb3 A G 3: 32,526,594 (GRCm39) V199A possibly damaging Het
Kctd12 G T 14: 103,219,622 (GRCm39) D85E probably damaging Het
Lama1 G A 17: 68,125,630 (GRCm39) R2929H probably damaging Het
Lgmn T A 12: 102,368,951 (GRCm39) Y176F probably benign Het
Lipo3 A G 19: 33,533,828 (GRCm39) F335L possibly damaging Het
Map2k3 T C 11: 60,833,150 (GRCm39) S46P probably benign Het
Megf8 C A 7: 25,058,159 (GRCm39) H2144Q probably benign Het
Neb A T 2: 52,124,365 (GRCm39) W3694R probably damaging Het
Nek10 A G 14: 14,861,684 (GRCm38) E580G probably benign Het
Obscn G A 11: 58,929,835 (GRCm39) P5930S probably damaging Het
Palld A G 8: 61,986,477 (GRCm39) F621L probably benign Het
Pkn2 A T 3: 142,509,348 (GRCm39) I732N probably damaging Het
Plpbp T A 8: 27,542,307 (GRCm39) I214N possibly damaging Het
Ppp1r37 A G 7: 19,266,048 (GRCm39) S573P probably benign Het
Prg4 C A 1: 150,336,432 (GRCm39) C97F probably damaging Het
Prmt2 T C 10: 76,053,208 (GRCm39) D269G possibly damaging Het
Ptbp3 T A 4: 59,517,640 (GRCm39) L80F probably damaging Het
Reep1 T A 6: 71,750,179 (GRCm39) F64I probably damaging Het
Srcap C A 7: 127,141,563 (GRCm39) P1720Q probably damaging Het
Ssr1 A T 13: 38,171,666 (GRCm39) F124I probably damaging Het
Tfpt T C 7: 3,623,835 (GRCm39) K71E probably benign Het
Tmem132a C A 19: 10,837,685 (GRCm39) G542C probably damaging Het
Tmem135 C A 7: 88,956,371 (GRCm39) L81F probably benign Het
Tmem135 A T 7: 88,956,372 (GRCm39) L81* probably null Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Washc5 A G 15: 59,212,739 (GRCm39) probably null Het
Zfp24 T C 18: 24,150,391 (GRCm39) E173G possibly damaging Het
Zgrf1 T C 3: 127,410,155 (GRCm39) I1814T probably damaging Het
Other mutations in Tbx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Tbx18 APN 9 87,587,676 (GRCm39) missense possibly damaging 0.90
IGL00832:Tbx18 APN 9 87,587,714 (GRCm39) missense probably damaging 1.00
IGL01287:Tbx18 APN 9 87,606,384 (GRCm39) missense probably damaging 0.98
IGL01406:Tbx18 APN 9 87,595,596 (GRCm39) missense probably damaging 0.99
IGL01587:Tbx18 APN 9 87,606,461 (GRCm39) missense probably damaging 0.99
IGL01898:Tbx18 APN 9 87,589,912 (GRCm39) missense possibly damaging 0.92
IGL02624:Tbx18 APN 9 87,609,459 (GRCm39) missense probably damaging 1.00
IGL03057:Tbx18 APN 9 87,612,882 (GRCm39) missense probably damaging 0.99
IGL03252:Tbx18 APN 9 87,587,633 (GRCm39) missense probably damaging 1.00
R0126:Tbx18 UTSW 9 87,611,706 (GRCm39) missense possibly damaging 0.50
R0243:Tbx18 UTSW 9 87,597,569 (GRCm39) splice site probably benign
R0374:Tbx18 UTSW 9 87,606,408 (GRCm39) missense probably damaging 0.97
R0666:Tbx18 UTSW 9 87,606,462 (GRCm39) missense probably benign 0.13
R2141:Tbx18 UTSW 9 87,597,706 (GRCm39) missense probably damaging 0.99
R2183:Tbx18 UTSW 9 87,587,789 (GRCm39) missense probably damaging 0.98
R2233:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R2234:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R2235:Tbx18 UTSW 9 87,606,403 (GRCm39) missense probably damaging 1.00
R3835:Tbx18 UTSW 9 87,611,689 (GRCm39) missense probably benign
R4214:Tbx18 UTSW 9 87,606,518 (GRCm39) missense probably damaging 1.00
R4606:Tbx18 UTSW 9 87,612,822 (GRCm39) missense possibly damaging 0.84
R4834:Tbx18 UTSW 9 87,609,502 (GRCm39) missense possibly damaging 0.48
R5112:Tbx18 UTSW 9 87,597,740 (GRCm39) missense probably damaging 1.00
R5887:Tbx18 UTSW 9 87,595,566 (GRCm39) missense possibly damaging 0.58
R6628:Tbx18 UTSW 9 87,597,588 (GRCm39) nonsense probably null
R7001:Tbx18 UTSW 9 87,609,457 (GRCm39) missense probably damaging 1.00
R7057:Tbx18 UTSW 9 87,587,317 (GRCm39) missense possibly damaging 0.94
R7167:Tbx18 UTSW 9 87,589,883 (GRCm39) missense probably damaging 1.00
R7368:Tbx18 UTSW 9 87,612,750 (GRCm39) missense probably benign
R8147:Tbx18 UTSW 9 87,606,411 (GRCm39) missense probably damaging 0.97
R8993:Tbx18 UTSW 9 87,612,770 (GRCm39) missense probably benign 0.00
R9263:Tbx18 UTSW 9 87,611,521 (GRCm39) missense probably damaging 0.97
R9291:Tbx18 UTSW 9 87,611,535 (GRCm39) missense probably damaging 1.00
R9396:Tbx18 UTSW 9 87,609,432 (GRCm39) missense probably damaging 1.00
R9420:Tbx18 UTSW 9 87,612,675 (GRCm39) missense probably benign
R9508:Tbx18 UTSW 9 87,587,926 (GRCm39) missense probably damaging 0.96
R9577:Tbx18 UTSW 9 87,611,512 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGCCATCATTCCTGACCTG -3'
(R):5'- GTGGCAATCTTCTAACACACC -3'

Sequencing Primer
(F):5'- GACCTGTCACCCTTCAGATAGG -3'
(R):5'- ACACACCACTAAGTTTAGATGGG -3'
Posted On 2018-07-23