Incidental Mutation 'R6661:Mbd4'
ID526842
Institutional Source Beutler Lab
Gene Symbol Mbd4
Ensembl Gene ENSMUSG00000030322
Gene Namemethyl-CpG binding domain protein 4
SynonymsMed1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010774.2; MGI:1333850

Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6661 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location115840697-115853371 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 115849155 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 271 (E271*)
Ref Sequence ENSEMBL: ENSMUSP00000125619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032469] [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000122816] [ENSMUST00000141305] [ENSMUST00000147282] [ENSMUST00000203643]
Predicted Effect probably null
Transcript: ENSMUST00000032469
AA Change: E292*
SMART Domains Protein: ENSMUSP00000032469
Gene: ENSMUSG00000030322
AA Change: E292*

DomainStartEndE-ValueType
MBD 66 142 1.25e-29 SMART
low complexity region 178 196 N/A INTRINSIC
PDB:1NGN|A 400 554 1e-111 PDB
SCOP:d1keaa_ 405 545 1e-23 SMART
Blast:ENDO3c 439 514 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038234
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112923
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122816
AA Change: E292*
SMART Domains Protein: ENSMUSP00000145433
Gene: ENSMUSG00000030322
AA Change: E292*

DomainStartEndE-ValueType
MBD 66 142 7.6e-32 SMART
low complexity region 178 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133830
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147282
AA Change: E271*
SMART Domains Protein: ENSMUSP00000125619
Gene: ENSMUSG00000030322
AA Change: E271*

DomainStartEndE-ValueType
MBD 45 121 1.25e-29 SMART
low complexity region 157 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203243
Predicted Effect probably benign
Transcript: ENSMUST00000203643
SMART Domains Protein: ENSMUSP00000144930
Gene: ENSMUSG00000030322

DomainStartEndE-ValueType
Pfam:HhH-GPD 56 168 2.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
MGI Phenotype Strain: 2447611
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele have an increased rate of DNA mutation, specifically at CpGs. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(6) Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap28 C A 17: 67,845,751 W675L probably damaging Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Ccr4 T C 9: 114,495,963 probably benign Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Gatb A G 3: 85,652,419 probably null Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nedd4 T A 9: 72,686,095 V150E probably damaging Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Plxnb1 T C 9: 109,104,299 C666R possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Selenbp2 A G 3: 94,702,514 D257G probably damaging Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Mbd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mbd4 APN 6 115849530 missense probably damaging 0.99
IGL01545:Mbd4 APN 6 115850797 missense probably damaging 1.00
IGL01657:Mbd4 APN 6 115849637 missense probably damaging 0.99
IGL02406:Mbd4 APN 6 115849025 missense possibly damaging 0.96
E0370:Mbd4 UTSW 6 115849155 missense possibly damaging 0.91
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0538:Mbd4 UTSW 6 115849482 missense probably damaging 0.99
R2085:Mbd4 UTSW 6 115848957 missense probably benign 0.01
R4405:Mbd4 UTSW 6 115849115 missense possibly damaging 0.92
R4464:Mbd4 UTSW 6 115849502 missense probably damaging 0.99
R4780:Mbd4 UTSW 6 115849384 missense probably benign
R4782:Mbd4 UTSW 6 115845322 missense possibly damaging 0.49
R4799:Mbd4 UTSW 6 115845322 missense probably benign 0.26
R4814:Mbd4 UTSW 6 115849299 missense possibly damaging 0.85
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4976:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R5126:Mbd4 UTSW 6 115848968 unclassified probably null
R5202:Mbd4 UTSW 6 115849402 missense probably damaging 0.96
R5485:Mbd4 UTSW 6 115850718 missense probably benign 0.21
R6179:Mbd4 UTSW 6 115845425 missense probably benign 0.00
R7008:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCATCCTGTAAAACACCAGTATG -3'
(R):5'- GTGACTGTTTTGAAAGGAACTGC -3'

Sequencing Primer
(F):5'- TCCTGTAAAACACCAGTATGCAAATG -3'
(R):5'- GACTGTTTTGAAAGGAACTGCAAGTC -3'
Posted On2018-07-23