Incidental Mutation 'R6661:Ccr4'
ID526848
Institutional Source Beutler Lab
Gene Symbol Ccr4
Ensembl Gene ENSMUSG00000047898
Gene Namechemokine (C-C motif) receptor 4
SynonymsCC CKR-4, Cmkbr4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6661 (G1)
Quality Score146.008
Status Validated
Chromosome9
Chromosomal Location114490316-114504916 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 114495963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054414] [ENSMUST00000215425] [ENSMUST00000215959]
Predicted Effect probably benign
Transcript: ENSMUST00000054414
SMART Domains Protein: ENSMUSP00000062677
Gene: ENSMUSG00000047898

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 50 319 2.9e-11 PFAM
Pfam:7tm_1 56 304 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215425
Predicted Effect probably benign
Transcript: ENSMUST00000215959
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased mortality, decreased tumor necrosis factor production, and decreased IL-1beta production following LPS administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap28 C A 17: 67,845,751 W675L probably damaging Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Gatb A G 3: 85,652,419 probably null Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Mbd4 C A 6: 115,849,155 E271* probably null Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nedd4 T A 9: 72,686,095 V150E probably damaging Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Plxnb1 T C 9: 109,104,299 C666R possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Selenbp2 A G 3: 94,702,514 D257G probably damaging Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Ccr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02625:Ccr4 APN 9 114492333 missense probably damaging 1.00
kentucky UTSW 9 114492646 missense probably damaging 1.00
P4748:Ccr4 UTSW 9 114492838 missense probably damaging 1.00
PIT4651001:Ccr4 UTSW 9 114492193 missense probably benign 0.08
R1117:Ccr4 UTSW 9 114492017 missense probably benign 0.00
R1542:Ccr4 UTSW 9 114492005 missense probably benign
R1954:Ccr4 UTSW 9 114492685 missense probably damaging 0.99
R2047:Ccr4 UTSW 9 114492565 missense probably damaging 1.00
R3157:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R3158:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R3159:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R4868:Ccr4 UTSW 9 114492833 missense probably benign
R5051:Ccr4 UTSW 9 114492646 missense probably damaging 1.00
R6102:Ccr4 UTSW 9 114496493 splice site probably null
R6475:Ccr4 UTSW 9 114492979 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTCTGCAAATGGAGACATC -3'
(R):5'- CTCAGGCTTCTTAATCTTGCTGGTG -3'

Sequencing Primer
(F):5'- TGGAGACATCTGCCTAACCCTG -3'
(R):5'- AATCTTGCTGGTGCTGGCC -3'
Posted On2018-07-23