Incidental Mutation 'R6661:Arhgap28'
ID526858
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6661 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67845751 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 675 (W675L)
Ref Sequence ENSEMBL: ENSMUSP00000128194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect probably damaging
Transcript: ENSMUST00000024840
AA Change: W725L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: W725L

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000163865
AA Change: W674L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: W674L

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164647
AA Change: W675L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: W675L

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166414
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Ccr4 T C 9: 114,495,963 probably benign Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Gatb A G 3: 85,652,419 probably null Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Mbd4 C A 6: 115,849,155 E271* probably null Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nedd4 T A 9: 72,686,095 V150E probably damaging Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Plxnb1 T C 9: 109,104,299 C666R possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Selenbp2 A G 3: 94,702,514 D257G probably damaging Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6928:Arhgap28 UTSW 17 67901299 small deletion probably benign
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTGCTTCTCAATGAGCAACGC -3'
(R):5'- TCTCTCTGATTGACCCTGGG -3'

Sequencing Primer
(F):5'- ACCGTCTCATGAGGAACTGTG -3'
(R):5'- CTGATTGACCCTGGGGATAGAGC -3'
Posted On2018-07-23