Incidental Mutation 'R6664:Ccdc18'
ID526903
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Namecoiled-coil domain containing 18
Synonyms4932411G06Rik, 1700021E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6664 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108132875-108233628 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108168100 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 479 (Q479*)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
Predicted Effect probably null
Transcript: ENSMUST00000047677
AA Change: Q479*
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: Q479*

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195973
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AU040320 A T 4: 126,835,650 Y535F probably damaging Het
Auh G C 13: 52,898,667 S138W probably damaging Het
Bmp2k A T 5: 97,088,130 K1137N probably benign Het
Btn1a1 A G 13: 23,459,320 Y320H probably benign Het
Cyp4f18 A T 8: 71,989,915 S399T probably benign Het
Dcaf13 T C 15: 39,118,888 L83P probably damaging Het
Fbxo45 T C 16: 32,238,416 N220S probably damaging Het
Fbxw16 T C 9: 109,438,258 M302V probably benign Het
Fgb A T 3: 83,046,759 S57R probably damaging Het
Fryl A G 5: 73,132,481 V134A probably damaging Het
Gatad2a A G 8: 69,917,489 L189P probably damaging Het
Gm438 T C 4: 144,777,399 *394W probably null Het
Ifitm7 T C 16: 13,983,749 T49A probably benign Het
Itih1 T C 14: 30,933,436 T601A probably damaging Het
Jmjd4 T C 11: 59,450,419 F59L probably benign Het
Magi2 C T 5: 20,702,397 S1323L probably benign Het
Map3k21 A G 8: 125,941,871 E732G probably benign Het
Nr4a3 G A 4: 48,056,006 R344Q probably damaging Het
Olfr340 A G 2: 36,453,098 N171S probably benign Het
Olfr678 T A 7: 105,070,188 S240R possibly damaging Het
Pik3cb T C 9: 99,094,538 T169A possibly damaging Het
Prl3a1 C A 13: 27,270,211 Y57* probably null Het
Ripor2 A T 13: 24,675,820 I164F probably damaging Het
Sik2 T C 9: 50,935,457 E146G probably damaging Het
Szt2 G A 4: 118,391,745 R581C probably damaging Het
Tango6 T A 8: 106,742,114 D747E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp945 A G 17: 22,852,365 S187P probably damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108196042 missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAGCCTACTTGATCGTGGTG -3'
(R):5'- ATGCAAAGTCTAAGAACTGCAC -3'

Sequencing Primer
(F):5'- CCTACTTGATCGTGGTGAATGATG -3'
(R):5'- GTCTAAGAACTGCACAATAATTCTTG -3'
Posted On2018-07-23