Mutagenetix > Incidental Mutation

Incidental Mutation 'R6664:Vmn2r111'

526921

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

044784-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R6664 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22766922-22792254 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22778032 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4fm5	T	C	4: 144,503,969 (GRCm39)	*394W	probably null	Het
AU040320	A	T	4: 126,729,443 (GRCm39)	Y535F	probably damaging	Het
Auh	G	C	13: 53,052,703 (GRCm39)	S138W	probably damaging	Het
Bmp2k	A	T	5: 97,235,989 (GRCm39)	K1137N	probably benign	Het
Btn1a1	A	G	13: 23,643,490 (GRCm39)	Y320H	probably benign	Het
Ccdc18	C	T	5: 108,315,966 (GRCm39)	Q479*	probably null	Het
Cyp4f18	A	T	8: 72,743,759 (GRCm39)	S399T	probably benign	Het
Dcaf13	T	C	15: 38,982,283 (GRCm39)	L83P	probably damaging	Het
Fbxo45	T	C	16: 32,057,234 (GRCm39)	N220S	probably damaging	Het
Fbxw16	T	C	9: 109,267,326 (GRCm39)	M302V	probably benign	Het
Fgb	A	T	3: 82,954,066 (GRCm39)	S57R	probably damaging	Het
Fryl	A	G	5: 73,289,824 (GRCm39)	V134A	probably damaging	Het
Gatad2a	A	G	8: 70,370,139 (GRCm39)	L189P	probably damaging	Het
Ifitm7	T	C	16: 13,801,613 (GRCm39)	T49A	probably benign	Het
Itih1	T	C	14: 30,655,393 (GRCm39)	T601A	probably damaging	Het
Jmjd4	T	C	11: 59,341,245 (GRCm39)	F59L	probably benign	Het
Magi2	C	T	5: 20,907,395 (GRCm39)	S1323L	probably benign	Het
Map3k21	A	G	8: 126,668,610 (GRCm39)	E732G	probably benign	Het
Nr4a3	G	A	4: 48,056,006 (GRCm39)	R344Q	probably damaging	Het
Or1j12	A	G	2: 36,343,110 (GRCm39)	N171S	probably benign	Het
Or52e5	T	A	7: 104,719,395 (GRCm39)	S240R	possibly damaging	Het
Pik3cb	T	C	9: 98,976,591 (GRCm39)	T169A	possibly damaging	Het
Prl3a1	C	A	13: 27,454,194 (GRCm39)	Y57*	probably null	Het
Ripor2	A	T	13: 24,859,803 (GRCm39)	I164F	probably damaging	Het
Sik2	T	C	9: 50,846,757 (GRCm39)	E146G	probably damaging	Het
Szt2	G	A	4: 118,248,942 (GRCm39)	R581C	probably damaging	Het
Tango6	T	A	8: 107,468,746 (GRCm39)	D747E	probably damaging	Het
Zfp945	A	G	17: 23,071,339 (GRCm39)	S187P	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22,767,734 (GRCm39)	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22,787,965 (GRCm39)	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22,787,997 (GRCm39)	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22,790,966 (GRCm39)	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22,767,718 (GRCm39)	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22,767,553 (GRCm39)	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22,790,373 (GRCm39)	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22,788,054 (GRCm39)	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22,767,265 (GRCm39)	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22,789,754 (GRCm39)	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22,787,837 (GRCm39)	missense	probably benign
IGL02519:Vmn2r111	APN	17	22,767,320 (GRCm39)	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22,790,031 (GRCm39)	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22,792,205 (GRCm39)	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22,778,023 (GRCm39)	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22,790,226 (GRCm39)	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22,789,839 (GRCm39)	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22,766,990 (GRCm39)	missense	probably benign
R0064:Vmn2r111	UTSW	17	22,791,053 (GRCm39)	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22,792,102 (GRCm39)	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22,790,097 (GRCm39)	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22,790,028 (GRCm39)	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22,790,028 (GRCm39)	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22,790,380 (GRCm39)	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22,788,042 (GRCm39)	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22,788,042 (GRCm39)	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22,767,041 (GRCm39)	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22,767,062 (GRCm39)	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22,767,395 (GRCm39)	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22,778,043 (GRCm39)	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22,792,085 (GRCm39)	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22,778,151 (GRCm39)	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22,790,142 (GRCm39)	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22,790,301 (GRCm39)	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22,778,096 (GRCm39)	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22,792,159 (GRCm39)	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22,767,637 (GRCm39)	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22,767,022 (GRCm39)	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22,790,124 (GRCm39)	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22,790,001 (GRCm39)	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22,767,083 (GRCm39)	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22,792,252 (GRCm39)	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22,767,470 (GRCm39)	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22,767,238 (GRCm39)	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6149:Vmn2r111	UTSW	17	22,767,796 (GRCm39)	missense	probably benign	0.00
R6207:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22,792,070 (GRCm39)	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22,790,889 (GRCm39)	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22,767,583 (GRCm39)	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22,790,226 (GRCm39)	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22,767,165 (GRCm39)	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22,767,695 (GRCm39)	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22,790,067 (GRCm39)	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22,767,380 (GRCm39)	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22,789,714 (GRCm39)	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22,792,083 (GRCm39)	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22,790,469 (GRCm39)	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22,792,073 (GRCm39)	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22,778,032 (GRCm39)	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22,767,562 (GRCm39)	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22,790,274 (GRCm39)	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22,778,024 (GRCm39)	missense	probably damaging	1.00
R8540:Vmn2r111	UTSW	17	22,778,023 (GRCm39)	critical splice donor site	probably null
R8557:Vmn2r111	UTSW	17	22,790,910 (GRCm39)	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22,792,194 (GRCm39)	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22,767,239 (GRCm39)	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22,767,011 (GRCm39)	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22,790,822 (GRCm39)	missense	probably benign
R9374:Vmn2r111	UTSW	17	22,787,859 (GRCm39)	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22,778,132 (GRCm39)	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22,767,676 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2018-07-23