Incidental Mutation 'R6665:Slc6a6'
ID526931
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6665 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91726039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185] [ENSMUST00000205480] [ENSMUST00000205828] [ENSMUST00000206545]
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: V131A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: V131A

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205443
Predicted Effect probably benign
Transcript: ENSMUST00000205480
Predicted Effect silent
Transcript: ENSMUST00000205663
Predicted Effect probably benign
Transcript: ENSMUST00000205828
Predicted Effect probably benign
Transcript: ENSMUST00000206545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206835
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Ccdc146 T C 5: 21,303,094 Y652C probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Col28a1 A G 6: 8,062,277 V671A probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Fam160b2 A T 14: 70,585,638 L659Q probably damaging Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hexb T C 13: 97,179,385 N380D probably benign Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Myoz3 A C 18: 60,576,423 L222R probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Rab32 T C 10: 10,558,102 probably benign Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
durango UTSW 6 91723471 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91741048 missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCATTCAGCCACTTGTCC -3'
(R):5'- ACTCCCAGAACTCGATGACG -3'

Sequencing Primer
(F):5'- AGCCACTTGTCCCTTTATCCAG -3'
(R):5'- TGAAGTTGGCAGTGCTAAGG -3'
Posted On2018-07-23