Incidental Mutation 'R6665:Myoz3'
ID526954
Institutional Source Beutler Lab
Gene Symbol Myoz3
Ensembl Gene ENSMUSG00000049173
Gene Namemyozenin 3
Synonyms4833419K08Rik, Fatz-3, calsarcin-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6665 (G1)
Quality Score172.009
Status Validated
Chromosome18
Chromosomal Location60576316-60591788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60576423 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 222 (L222R)
Ref Sequence ENSEMBL: ENSMUSP00000063108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025506] [ENSMUST00000056533]
Predicted Effect probably benign
Transcript: ENSMUST00000025506
SMART Domains Protein: ENSMUSP00000025506
Gene: ENSMUSG00000024604

DomainStartEndE-ValueType
ZnF_C3H1 159 185 8.15e-6 SMART
RRM 233 301 7.94e-18 SMART
low complexity region 325 345 N/A INTRINSIC
low complexity region 366 400 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000056533
AA Change: L222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063108
Gene: ENSMUSG00000049173
AA Change: L222R

DomainStartEndE-ValueType
Pfam:Calsarcin 1 244 1.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160353
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the skeletal muscle, and belongs to the myozenin family. Members of this family function as calcineurin-interacting proteins that help tether calcineurin to the sarcomere of cardiac and skeletal muscle. They play an important role in modulation of calcineurin signaling. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,904,479 probably null Het
Adamts16 T G 13: 70,779,570 K517Q probably damaging Het
Atp9b A C 18: 80,917,735 V87G probably benign Het
Avil A G 10: 127,020,525 K808E probably damaging Het
Bin2 T C 15: 100,656,795 E49G probably damaging Het
Ccdc146 T C 5: 21,303,094 Y652C probably damaging Het
Cd6 T C 19: 10,791,003 N541D probably benign Het
Col28a1 A G 6: 8,062,277 V671A probably benign Het
Dock6 C T 9: 21,839,912 C355Y probably damaging Het
Dsc2 A G 18: 20,050,148 F71S probably damaging Het
Dusp8 G A 7: 142,090,105 P24S probably damaging Het
Dysf A G 6: 84,130,116 Y1151C probably benign Het
Fam160b2 A T 14: 70,585,638 L659Q probably damaging Het
Frem2 T C 3: 53,654,656 Y810C probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hexb T C 13: 97,179,385 N380D probably benign Het
Ice1 T C 13: 70,603,473 E1498G possibly damaging Het
Lrif1 T A 3: 106,735,343 probably null Het
Myo9a G T 9: 59,871,872 G1637V probably benign Het
Myod1 A T 7: 46,376,857 H62L probably damaging Het
Naca T A 10: 128,048,358 N2180K probably damaging Het
Olfr809 T C 10: 129,776,247 F111S probably damaging Het
Pik3cb A G 9: 99,073,649 V405A probably benign Het
Prkdc T C 16: 15,786,050 probably null Het
Rab32 T C 10: 10,558,102 probably benign Het
Serpinb10 A C 1: 107,546,867 N253T possibly damaging Het
Slc13a5 C T 11: 72,260,360 V131I probably damaging Het
Slc25a40 A G 5: 8,452,788 N290S probably benign Het
Slc6a6 T C 6: 91,726,039 V131A probably benign Het
Spef2 A T 15: 9,600,518 probably null Het
Stxbp2 A G 8: 3,641,998 M547V probably benign Het
Tmem247 A T 17: 86,918,570 Q146L probably benign Het
Vmn2r67 T C 7: 85,136,692 I702V probably benign Het
Zmynd15 T C 11: 70,464,810 S436P probably benign Het
Other mutations in Myoz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Myoz3 UTSW 18 60578951 missense probably damaging 1.00
R1564:Myoz3 UTSW 18 60580842 missense probably benign 0.00
R2174:Myoz3 UTSW 18 60590224 missense probably benign 0.00
R5708:Myoz3 UTSW 18 60579032 missense probably damaging 1.00
R5734:Myoz3 UTSW 18 60579471 missense possibly damaging 0.50
R6530:Myoz3 UTSW 18 60579520 splice site probably null
R7162:Myoz3 UTSW 18 60576413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGTGTGAAAACGCTTTGC -3'
(R):5'- TTGCTGCCTAGAAGGGGAAAC -3'

Sequencing Primer
(F):5'- CTAGGCTACAGAGTGAGATCCTGTC -3'
(R):5'- GAAACTGAGGCCCCAAGAGAC -3'
Posted On2018-07-23