Incidental Mutation 'R6666:Ddias'
ID526974
Institutional Source Beutler Lab
Gene Symbol Ddias
Ensembl Gene ENSMUSG00000030641
Gene NameDNA damage-induced apoptosis suppressor
Synonymsnoxin, 4632434I11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location92857525-92874247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92858081 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 875 (D875E)
Ref Sequence ENSEMBL: ENSMUSP00000032877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032877] [ENSMUST00000208356] [ENSMUST00000209074]
Predicted Effect probably benign
Transcript: ENSMUST00000032877
AA Change: D875E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032877
Gene: ENSMUSG00000030641
AA Change: D875E

DomainStartEndE-ValueType
Pfam:Rep_fac-A_C 7 118 2.1e-14 PFAM
low complexity region 197 209 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 727 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208356
Predicted Effect probably benign
Transcript: ENSMUST00000209074
Meta Mutation Damage Score 0.1484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Gtpbp3 A G 8: 71,490,938 D212G possibly damaging Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Ddias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Ddias APN 7 92866622 missense probably damaging 0.98
IGL02820:Ddias APN 7 92859343 missense probably benign 0.07
I0000:Ddias UTSW 7 92866640 missense possibly damaging 0.69
R0094:Ddias UTSW 7 92859900 missense possibly damaging 0.61
R0482:Ddias UTSW 7 92859528 missense probably benign 0.41
R0883:Ddias UTSW 7 92859337 missense probably benign
R1131:Ddias UTSW 7 92859886 missense possibly damaging 0.92
R1722:Ddias UTSW 7 92860042 missense possibly damaging 0.63
R1758:Ddias UTSW 7 92859363 missense probably benign 0.03
R1937:Ddias UTSW 7 92858622 missense probably benign 0.07
R2067:Ddias UTSW 7 92859699 missense possibly damaging 0.79
R2124:Ddias UTSW 7 92858256 missense probably benign 0.00
R2483:Ddias UTSW 7 92859592 missense probably benign 0.13
R3623:Ddias UTSW 7 92859592 missense probably benign 0.13
R3690:Ddias UTSW 7 92860158 missense probably benign 0.24
R4015:Ddias UTSW 7 92859861 missense probably benign 0.06
R4021:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4022:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4384:Ddias UTSW 7 92858223 missense probably damaging 0.98
R4410:Ddias UTSW 7 92858079 missense probably benign 0.04
R4691:Ddias UTSW 7 92858816 missense probably damaging 0.99
R5653:Ddias UTSW 7 92858729 missense probably damaging 1.00
R6853:Ddias UTSW 7 92859565 missense possibly damaging 0.46
X0027:Ddias UTSW 7 92858995 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTATTATTCTGAAAAGCCATCCCC -3'
(R):5'- CCTCAGCCTGCTCAAAGAATG -3'

Sequencing Primer
(F):5'- TTATTCTGAAAAGCCATCCCCAACTG -3'
(R):5'- TCAGCCTGCTCAAAGAATGTAAAAG -3'
Posted On2018-07-23