Incidental Mutation 'R6666:Gtpbp3'
ID526978
Institutional Source Beutler Lab
Gene Symbol Gtpbp3
Ensembl Gene ENSMUSG00000007610
Gene NameGTP binding protein 3
Synonyms2410009F13Rik, Gtpbp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R6666 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71488103-71499583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71490938 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 212 (D212G)
Ref Sequence ENSEMBL: ENSMUSP00000114193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007754
AA Change: D212G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610
AA Change: D212G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093450
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124349
Predicted Effect probably benign
Transcript: ENSMUST00000127741
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146551
Predicted Effect possibly damaging
Transcript: ENSMUST00000150969
AA Change: D212G

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610
AA Change: D212G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
AA Change: D213G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610
AA Change: D213G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213382
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik C A 10: 21,593,329 probably null Het
Arhgap24 A G 5: 102,552,297 probably null Het
Atp12a G T 14: 56,373,364 V322L probably benign Het
Capza1 A C 3: 104,828,606 probably null Het
Cela3a A T 4: 137,403,864 S188T probably benign Het
Cplx1 G T 5: 108,520,165 Y123* probably null Het
Ddias A T 7: 92,858,081 D875E probably benign Het
Dnah3 T C 7: 120,070,949 E715G probably benign Het
Fam83e A G 7: 45,727,002 T380A probably benign Het
Fancd2 T C 6: 113,585,509 V1270A probably damaging Het
Foxh1 A G 15: 76,668,413 F367S probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gprc5a A G 6: 135,079,475 I307V probably benign Het
Helb A G 10: 120,084,951 V1029A probably damaging Het
Il22ra1 A T 4: 135,750,461 H281L probably damaging Het
Il2rb TAGTCA TAGTCAGTCA 15: 78,481,834 probably null Het
Itga3 T C 11: 95,065,826 T170A probably benign Het
Kdm3a T C 6: 71,611,990 E345G probably benign Het
Kif11 T C 19: 37,409,766 I680T probably benign Het
Klhl28 C T 12: 64,943,527 D547N probably benign Het
Limk2 T A 11: 3,360,493 E49D probably damaging Het
Lmbrd2 T A 15: 9,151,569 F120I probably benign Het
Mefv T A 16: 3,707,998 N802Y possibly damaging Het
Ms4a2 C T 19: 11,618,423 S168N probably benign Het
Myct1 T C 10: 5,604,333 S67P probably damaging Het
Myh4 A G 11: 67,251,812 E933G probably damaging Het
Naif1 C A 2: 32,454,851 T189K probably damaging Het
Nppb A G 4: 147,986,006 I11V probably benign Het
Nr3c1 T C 18: 39,487,147 D29G probably damaging Het
Nrcam A G 12: 44,571,555 Y782C probably damaging Het
Olfr1154 T A 2: 87,903,508 H56L probably damaging Het
Olfr366 A T 2: 37,220,319 I277F probably damaging Het
Olfr558 T C 7: 102,709,928 probably null Het
Parp1 A G 1: 180,585,951 T375A probably benign Het
Pcdhgb1 G T 18: 37,681,493 E346* probably null Het
Pds5b G T 5: 150,778,166 S754I probably damaging Het
Scnn1g G A 7: 121,767,388 D603N probably benign Het
Slitrk5 A G 14: 111,680,102 D386G probably damaging Het
Trmt1 T C 8: 84,698,454 L493P probably damaging Het
Vrk1 A G 12: 106,058,651 E262G probably damaging Het
Wfs1 T C 5: 36,967,619 T567A possibly damaging Het
Zbtb11 A T 16: 56,006,252 K846I probably damaging Het
Zfp318 A G 17: 46,409,214 T1113A probably benign Het
Zfp654 A T 16: 64,786,233 S535R probably benign Het
Other mutations in Gtpbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Gtpbp3 APN 8 71490434 missense probably damaging 1.00
IGL02476:Gtpbp3 APN 8 71492598 missense probably damaging 1.00
IGL02669:Gtpbp3 APN 8 71490902 missense probably damaging 1.00
IGL02885:Gtpbp3 APN 8 71489420 unclassified probably benign
IGL03038:Gtpbp3 APN 8 71489303 missense possibly damaging 0.94
R0267:Gtpbp3 UTSW 8 71491497 missense probably damaging 1.00
R0442:Gtpbp3 UTSW 8 71491491 missense probably damaging 0.97
R0639:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R0673:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R1844:Gtpbp3 UTSW 8 71492628 missense probably benign 0.05
R1957:Gtpbp3 UTSW 8 71490455 missense probably damaging 1.00
R2996:Gtpbp3 UTSW 8 71489496 missense possibly damaging 0.69
R3703:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R3705:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R4084:Gtpbp3 UTSW 8 71490512 missense probably benign 0.00
R4181:Gtpbp3 UTSW 8 71491467 missense probably damaging 1.00
R4705:Gtpbp3 UTSW 8 71491114 missense probably benign 0.23
R5081:Gtpbp3 UTSW 8 71490382 missense probably damaging 1.00
R5260:Gtpbp3 UTSW 8 71489418 unclassified probably benign
R5619:Gtpbp3 UTSW 8 71491048 intron probably benign
R5844:Gtpbp3 UTSW 8 71492555 missense probably benign 0.01
R7092:Gtpbp3 UTSW 8 71492265 missense probably benign
R7295:Gtpbp3 UTSW 8 71489495 missense possibly damaging 0.81
X0013:Gtpbp3 UTSW 8 71492693 missense possibly damaging 0.77
X0021:Gtpbp3 UTSW 8 71490517 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGCATGTTCACCCATTCATGTG -3'
(R):5'- GTGACCACAACATTTGCCCC -3'

Sequencing Primer
(F):5'- TTCAGACTTCTGGAAGAGCAGCC -3'
(R):5'- TAGCATCTCGCAGGTGGGAAC -3'
Posted On2018-07-23