Incidental Mutation 'R6667:Tti1'
ID527008
Institutional Source Beutler Lab
Gene Symbol Tti1
Ensembl Gene ENSMUSG00000027650
Gene NameTELO2 interacting protein 1
Synonyms2610036D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6667 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location157981803-158028433 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 158008427 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 297 (C297*)
Ref Sequence ENSEMBL: ENSMUSP00000105148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029179] [ENSMUST00000109522] [ENSMUST00000124338]
Predicted Effect probably null
Transcript: ENSMUST00000029179
AA Change: C297*
SMART Domains Protein: ENSMUSP00000029179
Gene: ENSMUSG00000027650
AA Change: C297*

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109522
AA Change: C297*
SMART Domains Protein: ENSMUSP00000105148
Gene: ENSMUSG00000027650
AA Change: C297*

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 306 319 N/A INTRINSIC
low complexity region 401 411 N/A INTRINSIC
low complexity region 494 504 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
SCOP:d1gw5a_ 855 1044 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124338
SMART Domains Protein: ENSMUSP00000116592
Gene: ENSMUSG00000027650

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126541
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Tti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tti1 APN 2 158008966 missense probably damaging 1.00
IGL00434:Tti1 APN 2 158008965 missense probably damaging 1.00
IGL00820:Tti1 APN 2 158008968 missense probably damaging 1.00
IGL00949:Tti1 APN 2 157982399 missense probably benign 0.00
IGL01080:Tti1 APN 2 157982459 missense probably damaging 1.00
IGL01084:Tti1 APN 2 157982459 missense probably damaging 1.00
IGL01339:Tti1 APN 2 158009130 missense possibly damaging 0.80
IGL01685:Tti1 APN 2 158000785 missense probably benign 0.01
IGL01866:Tti1 APN 2 158007698 missense probably benign 0.27
IGL01903:Tti1 APN 2 158000622 missense probably benign 0.01
IGL03142:Tti1 APN 2 158000677 missense probably damaging 0.99
IGL03173:Tti1 APN 2 158007012 unclassified probably benign
IGL03385:Tti1 APN 2 157993025 missense possibly damaging 0.86
R0413:Tti1 UTSW 2 157995476 missense probably benign 0.00
R0601:Tti1 UTSW 2 157993372 missense probably damaging 0.99
R1718:Tti1 UTSW 2 158008224 missense probably benign 0.40
R1760:Tti1 UTSW 2 157993035 missense possibly damaging 0.87
R1761:Tti1 UTSW 2 158007697 missense probably benign 0.01
R1968:Tti1 UTSW 2 158009046 missense possibly damaging 0.66
R2054:Tti1 UTSW 2 158007445 missense possibly damaging 0.79
R2131:Tti1 UTSW 2 158000743 missense probably benign
R3886:Tti1 UTSW 2 158008950 missense possibly damaging 0.74
R4479:Tti1 UTSW 2 158008395 missense possibly damaging 0.95
R4647:Tti1 UTSW 2 158007020 unclassified probably benign
R5124:Tti1 UTSW 2 158008195 missense probably damaging 0.99
R5145:Tti1 UTSW 2 158008512 missense probably benign 0.30
R5852:Tti1 UTSW 2 158000673 missense probably damaging 1.00
R6714:Tti1 UTSW 2 158007051 missense possibly damaging 0.73
R6719:Tti1 UTSW 2 157982300 missense probably benign 0.01
R7143:Tti1 UTSW 2 158007676 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGACGCCTCAGCACTGTAC -3'
(R):5'- TAAACAAGGTCACAGCATTGTCG -3'

Sequencing Primer
(F):5'- TCAGCACTGTACTGCACCG -3'
(R):5'- ACAGCATTGTCGTGTCTTCTCTAAAG -3'
Posted On2018-07-23