Incidental Mutation 'R6667:Epha5'
ID527015
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6667 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84071191 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 741 (D741G)
Ref Sequence ENSEMBL: ENSMUSP00000060646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably damaging
Transcript: ENSMUST00000053733
AA Change: D741G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: D741G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113398
AA Change: D793G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: D793G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113399
AA Change: D905G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: D905G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113401
AA Change: D718G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: D718G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113403
AA Change: D905G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: D905G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113406
AA Change: D882G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: D882G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 intron probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGGCAAAGGTCCTTCCAG -3'
(R):5'- GCTTTTCAACATGTTCAAAACCCC -3'

Sequencing Primer
(F):5'- GGCAAAGGTCCTTCCAGGTATAATTG -3'
(R):5'- TTGCAACAAATAAAAGTAGTTGTGG -3'
Posted On2018-07-23