Incidental Mutation 'R6667:Rtn2'
ID527020
Institutional Source Beutler Lab
Gene Symbol Rtn2
Ensembl Gene ENSMUSG00000030401
Gene Namereticulon 2 (Z-band associated protein)
SynonymsNspl1
MMRRC Submission
Accession Numbers

Genbank: NM_013648, NM_001025364

Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R6667 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19282624-19296160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19287259 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 188 (E188G)
Ref Sequence ENSEMBL: ENSMUSP00000032559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032559] [ENSMUST00000108468]
Predicted Effect probably benign
Transcript: ENSMUST00000032559
AA Change: E188G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000032559
Gene: ENSMUSG00000030401
AA Change: E188G

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 70 85 N/A INTRINSIC
low complexity region 119 144 N/A INTRINSIC
Pfam:Reticulon 272 436 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108468
SMART Domains Protein: ENSMUSP00000104108
Gene: ENSMUSG00000030401

DomainStartEndE-ValueType
Pfam:Reticulon 5 175 3.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209186
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are necessary for proper generation of tubular endoplasmic reticulum and likely play a role in intracellular vesicular transport. Alternatively spliced transcript variants encoding different isoforms have been identified. Mutations at this locus have been associated with autosomal dominant spastic paraplegia-12. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice heterozygous and homozygous for an allele disrupting the skeletal isoform exhibit abollished or severely impaired glucose uptake in skeletal muscle. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Rtn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Rtn2 APN 7 19293111 missense probably damaging 1.00
G5030:Rtn2 UTSW 7 19293174 missense probably damaging 1.00
R0067:Rtn2 UTSW 7 19294471 splice site probably benign
R2036:Rtn2 UTSW 7 19293739 missense probably damaging 1.00
R2240:Rtn2 UTSW 7 19286829 unclassified probably null
R4111:Rtn2 UTSW 7 19286844 missense probably damaging 1.00
R4274:Rtn2 UTSW 7 19287324 missense probably benign 0.00
R4678:Rtn2 UTSW 7 19293895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCATCCCTAGCCTGAGC -3'
(R):5'- AGCCGCCAATGCTCTTCTAC -3'

Sequencing Primer
(F):5'- ATCCCTAGCCTGAGCCAGTC -3'
(R):5'- TCTTCTACCACATTCAGCAGAGG -3'
Posted On2018-07-23