Incidental Mutation 'R6667:Tbata'
ID527029
Institutional Source Beutler Lab
Gene Symbol Tbata
Ensembl Gene ENSMUSG00000020096
Gene Namethymus, brain and testes associated
SynonymsSpatial, 1700021K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6667 (G1)
Quality Score162.009
Status Not validated
Chromosome10
Chromosomal Location61171954-61188841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61185363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 262 (L262P)
Ref Sequence ENSEMBL: ENSMUSP00000113902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035894] [ENSMUST00000079235] [ENSMUST00000121297] [ENSMUST00000122261] [ENSMUST00000126831] [ENSMUST00000131879] [ENSMUST00000140456] [ENSMUST00000143207] [ENSMUST00000148181] [ENSMUST00000151886]
Predicted Effect probably damaging
Transcript: ENSMUST00000035894
AA Change: L296P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036422
Gene: ENSMUSG00000020096
AA Change: L296P

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Pfam:SPATIAL 123 316 2.8e-64 PFAM
low complexity region 335 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079235
SMART Domains Protein: ENSMUSP00000078227
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
Pfam:SPATIAL 128 230 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121297
SMART Domains Protein: ENSMUSP00000113253
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 191 2.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122261
AA Change: L262P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113902
Gene: ENSMUSG00000020096
AA Change: L262P

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
Pfam:SPATIAL 82 282 6.7e-76 PFAM
low complexity region 301 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126831
SMART Domains Protein: ENSMUSP00000119957
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
Pfam:SPATIAL 1 155 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131879
SMART Domains Protein: ENSMUSP00000118942
Gene: ENSMUSG00000020096

DomainStartEndE-ValueType
low complexity region 58 70 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140456
Predicted Effect probably benign
Transcript: ENSMUST00000143207
Predicted Effect probably benign
Transcript: ENSMUST00000148181
Predicted Effect probably benign
Transcript: ENSMUST00000151886
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased thymic pithelial cells and total thymocyte numbers without altering T cell development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Tbata
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Tbata APN 10 61175960 nonsense probably null
IGL02311:Tbata APN 10 61179455 nonsense probably null
R0417:Tbata UTSW 10 61180339 missense probably damaging 1.00
R1537:Tbata UTSW 10 61183491 splice site probably null
R1956:Tbata UTSW 10 61183477 missense probably damaging 0.99
R1959:Tbata UTSW 10 61175844 missense possibly damaging 0.86
R2138:Tbata UTSW 10 61179284 missense probably benign 0.40
R4835:Tbata UTSW 10 61183353 missense probably damaging 1.00
R6261:Tbata UTSW 10 61175865 missense possibly damaging 0.92
X0066:Tbata UTSW 10 61188605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGAACCTTTAGGGGAACC -3'
(R):5'- GTATCTGCCCTGCGAATCAG -3'

Sequencing Primer
(F):5'- GAACCAGTTTGCCACGCC -3'
(R):5'- CTGCGAATCAGGAACAAGATC -3'
Posted On2018-07-23