Incidental Mutation 'R6667:Nalcn'
ID527039
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6667 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123321323 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 837 (L837P)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
Predicted Effect probably damaging
Transcript: ENSMUST00000000201
AA Change: L837P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: L837P

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Setd4 C A 16: 93,590,030 R260L probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCCCATTAAGACTACACTGTC -3'
(R):5'- CAGTGCGCTACAGAAATGCAC -3'

Sequencing Primer
(F):5'- CATTAAGACTACACTGTCCTTTCG -3'
(R):5'- TGCGCTACAGAAATGCACAAAGAG -3'
Posted On2018-07-23