Incidental Mutation 'R6667:Setd4'
ID527042
Institutional Source Beutler Lab
Gene Symbol Setd4
Ensembl Gene ENSMUSG00000022948
Gene NameSET domain containing 4
SynonymsORF21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6667 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location93583457-93604063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93590030 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 260 (R260L)
Ref Sequence ENSEMBL: ENSMUSP00000023669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023669] [ENSMUST00000113951]
Predicted Effect probably benign
Transcript: ENSMUST00000023669
AA Change: R260L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023669
Gene: ENSMUSG00000022948
AA Change: R260L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 3.2e-11 PFAM
Pfam:Rubis-subs-bind 306 424 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113951
AA Change: R260L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109584
Gene: ENSMUSG00000022948
AA Change: R260L

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:SET 58 272 9.1e-14 PFAM
Pfam:Rubis-subs-bind 308 424 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156298
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3100002H09Rik G T 4: 124,610,642 A39E probably damaging Het
Agtr1b T A 3: 20,315,749 N231I possibly damaging Het
Alpk2 T C 18: 65,307,740 E661G probably damaging Het
Ankrd26 C T 6: 118,507,788 S1496N probably benign Het
Asah2 T C 19: 31,995,358 N659S probably benign Het
Atp12a T C 14: 56,384,188 V760A possibly damaging Het
Casp2 T C 6: 42,279,836 C343R probably damaging Het
Cblb T A 16: 52,152,644 M446K possibly damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Ddit4l A G 3: 137,626,121 K83E probably benign Het
E430018J23Rik A G 7: 127,393,423 M5T probably benign Het
Epc2 A G 2: 49,522,669 T220A probably damaging Het
Epha5 T C 5: 84,071,191 D741G probably damaging Het
Flg2 A T 3: 93,201,761 R365S possibly damaging Het
Ggn A T 7: 29,172,668 H491L possibly damaging Het
Gm21119 T C 8: 20,621,939 S267P probably benign Het
Gm8332 A T 12: 88,249,705 D132E unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ighv6-4 A G 12: 114,406,532 V100A probably benign Het
Invs A T 4: 48,402,870 Y501F possibly damaging Het
Iqcm G T 8: 75,753,352 G313W probably damaging Het
Jph2 A G 2: 163,376,286 S157P probably damaging Het
Mast4 T C 13: 102,737,496 E1596G probably damaging Het
Mllt6 T A 11: 97,676,934 L759Q probably damaging Het
Nalcn A G 14: 123,321,323 L837P probably damaging Het
Neb G A 2: 52,147,189 T6836I probably damaging Het
Nol12 T A 15: 78,940,080 D133E probably benign Het
Olfr1136 A G 2: 87,693,570 V104A probably benign Het
Oxtr C A 6: 112,477,099 probably benign Het
Pcmt1 A G 10: 7,663,149 L38P probably damaging Het
Pik3r2 T C 8: 70,769,173 Y617C probably damaging Het
Prl7a2 T C 13: 27,661,041 N121D probably benign Het
Pvr G T 7: 19,905,802 Q380K probably benign Het
Rtn2 A G 7: 19,287,259 E188G probably benign Het
Six5 A G 7: 19,096,569 N374D probably benign Het
Slc9b1 T C 3: 135,371,965 I140T probably damaging Het
Supt16 A G 14: 52,172,063 F797L probably damaging Het
Tbata T C 10: 61,185,363 L262P probably damaging Het
Tti1 A T 2: 158,008,427 C297* probably null Het
Ush1c C A 7: 46,225,624 G139C probably damaging Het
Vmn1r1 C T 1: 182,157,777 V108I probably benign Het
Vmn2r116 C T 17: 23,401,092 T600I probably damaging Het
Zfp873 A G 10: 82,060,589 T422A probably benign Het
Zfp943 G A 17: 21,992,908 C325Y probably damaging Het
Other mutations in Setd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Setd4 APN 16 93591239 missense probably damaging 1.00
IGL02217:Setd4 APN 16 93593295 missense probably damaging 1.00
R0370:Setd4 UTSW 16 93591118 missense probably damaging 0.99
R0573:Setd4 UTSW 16 93589946 missense probably benign
R1103:Setd4 UTSW 16 93585194 missense probably benign 0.01
R1631:Setd4 UTSW 16 93593248 nonsense probably null
R1826:Setd4 UTSW 16 93591299 nonsense probably null
R2356:Setd4 UTSW 16 93590983 missense probably damaging 1.00
R2360:Setd4 UTSW 16 93586234 splice site probably benign
R4362:Setd4 UTSW 16 93583686 unclassified probably null
R4630:Setd4 UTSW 16 93591226 missense probably benign 0.00
R4823:Setd4 UTSW 16 93589950 missense probably benign 0.00
R5004:Setd4 UTSW 16 93591245 missense probably benign 0.02
R5257:Setd4 UTSW 16 93596333 missense probably damaging 0.98
R6798:Setd4 UTSW 16 93589953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACAGCTCTTTCCATTAGAAC -3'
(R):5'- TCCATGACTGGAGTTCCTCC -3'

Sequencing Primer
(F):5'- CTTTCCATTAGAACGGGAAATAACC -3'
(R):5'- AAGTGCAGGAGTCGGATTCTC -3'
Posted On2018-07-23