Incidental Mutation 'R6668:Nfkbid'
ID527064
Institutional Source Beutler Lab
Gene Symbol Nfkbid
Ensembl Gene ENSMUSG00000036931
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, delta
SynonymsIkappaBNS
MMRRC Submission
Accession Numbers

Genbank: NM_172142; MGI: 3041243

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30421732-30428746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30424441 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 142 (L142Q)
Ref Sequence ENSEMBL: ENSMUSP00000103811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046177] [ENSMUST00000075062] [ENSMUST00000108175] [ENSMUST00000108176] [ENSMUST00000208740]
Predicted Effect probably benign
Transcript: ENSMUST00000046177
SMART Domains Protein: ENSMUSP00000042317
Gene: ENSMUSG00000036931

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075062
SMART Domains Protein: ENSMUSP00000074573
Gene: ENSMUSG00000064109

DomainStartEndE-ValueType
Pfam:DAP10 1 79 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108175
SMART Domains Protein: ENSMUSP00000103810
Gene: ENSMUSG00000036931

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108176
AA Change: L142Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103811
Gene: ENSMUSG00000036931
AA Change: L142Q

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207504
Predicted Effect probably benign
Transcript: ENSMUST00000208740
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele produce higher levels of IL-6 following stimulation and are more susceptible to chemically induced endotoxin shock and colitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Nfkbid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Nfkbid APN 7 30425264 nonsense probably null
IGL02809:Nfkbid APN 7 30425235 missense possibly damaging 0.60
bumble UTSW 7 30425411 critical splice donor site probably benign
R1515:Nfkbid UTSW 7 30425356 missense probably benign 0.00
R5550:Nfkbid UTSW 7 30426001 missense probably damaging 0.99
R6190:Nfkbid UTSW 7 30425737 missense probably damaging 1.00
R6994:Nfkbid UTSW 7 30425767 missense probably benign
R7137:Nfkbid UTSW 7 30426256 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGAGACTGTGGATTCCGGAC -3'
(R):5'- AGCAAAACTCCCAATAGTCTTTCTG -3'

Sequencing Primer
(F):5'- TGGATTCCGGACCTGGCAAC -3'
(R):5'- CCTATTATTGTGGCTAGGGCAATC -3'
Posted On2018-07-23