Incidental Mutation 'R6668:Amacr'
ID527081
Institutional Source Beutler Lab
Gene Symbol Amacr
Ensembl Gene ENSMUSG00000022244
Gene Namealpha-methylacyl-CoA racemase
SynonymsMacr1, 2-arylpropionyl-CoA epimerase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R6668 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10981756-10996626 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10983382 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 93 (T93A)
Ref Sequence ENSEMBL: ENSMUSP00000066915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022853] [ENSMUST00000070877] [ENSMUST00000110523]
Predicted Effect probably benign
Transcript: ENSMUST00000022853
SMART Domains Protein: ENSMUSP00000022853
Gene: ENSMUSG00000058914

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
C1Q 111 245 2.26e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070877
AA Change: T93A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066915
Gene: ENSMUSG00000022244
AA Change: T93A

DomainStartEndE-ValueType
Pfam:CoA_transf_3 3 349 1.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110523
SMART Domains Protein: ENSMUSP00000106152
Gene: ENSMUSG00000058914

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 127 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
C1Q 184 318 2.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228886
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a racemase. The encoded enzyme interconverts pristanoyl-CoA and C27-bile acylCoAs between their (R)- and (S)-stereoisomers. The conversion to the (S)-stereoisomers is necessary for degradation of these substrates by peroxisomal beta-oxidation. Encoded proteins from this locus localize to both mitochondria and peroxisomes. Mutations in this gene may be associated with adult-onset sensorimotor neuropathy, pigmentary retinopathy, and adrenomyeloneuropathy due to defects in bile acid synthesis. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the upstream neighboring C1QTNF3 (C1q and tumor necrosis factor related protein 3) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice display impaired bile acid synthesis and with dietary phytol supplementation develop liver degeneration and induced mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Sars2 G A 7: 28,747,004 E194K probably benign Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Amacr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0487:Amacr UTSW 15 10984749 missense probably benign 0.26
R0565:Amacr UTSW 15 10981946 missense possibly damaging 0.95
R0965:Amacr UTSW 15 10984805 missense probably damaging 1.00
R2425:Amacr UTSW 15 10983368 missense possibly damaging 0.67
R3980:Amacr UTSW 15 10988929 nonsense probably null
R4822:Amacr UTSW 15 10983410 missense probably damaging 1.00
R4847:Amacr UTSW 15 10994872 nonsense probably null
R6362:Amacr UTSW 15 10984805 missense probably damaging 0.99
X0062:Amacr UTSW 15 10988886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTTTGCCCCGTAAAAGG -3'
(R):5'- TGTACTTCCTGATTTTGGAGCC -3'

Sequencing Primer
(F):5'- ATTGGGAAGCTCCTCTCTAGCAG -3'
(R):5'- GTACTTCCTGATTTTGGAGCCAGTTC -3'
Posted On2018-07-23