Incidental Mutation 'R6670:Grap'
ID 527108
Institutional Source Beutler Lab
Gene Symbol Grap
Ensembl Gene ENSMUSG00000004837
Gene Name GRB2-related adaptor protein
Synonyms 8430435N19Rik
MMRRC Submission 044790-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6670 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 61544091-61563610 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61551064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000004959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004959]
AlphaFold Q9CX99
Predicted Effect probably damaging
Transcript: ENSMUST00000004959
AA Change: D32G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004959
Gene: ENSMUSG00000004837
AA Change: D32G

DomainStartEndE-ValueType
SH3 1 57 5.43e-18 SMART
SH2 58 141 1.9e-33 SMART
SH3 161 216 3.32e-22 SMART
Meta Mutation Damage Score 0.2978 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GRB2/Sem5/Drk family and functions as a cytoplasmic signaling protein which contains an SH2 domain flanked by two SH3 domains. The SH2 domain interacts with ligand-activated receptors for stem cell factor and erythropoietin, and facilitates the formation of a stable complex with the BCR-ABL oncoprotein. This protein also associates with the Ras guanine nucleotide exchange factor SOS1 (son of sevenless homolog 1) through its N-terminal SH3 domain. In general, it couples signals from receptor and cytoplasmic tyrosine kinases to the Ras signaling pathway. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display a greater proliferative T cell response to TCR stimulation. In all other respects, they are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,827,850 (GRCm39) 1544 probably benign Het
Acsm3 T A 7: 119,379,978 (GRCm39) probably null Het
AW551984 T C 9: 39,504,292 (GRCm39) D558G probably damaging Het
Bcl9l GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC 9: 44,418,369 (GRCm39) probably benign Het
Brd8dc A G 18: 34,719,319 (GRCm39) V167A possibly damaging Het
Ccdc12 T G 9: 110,537,595 (GRCm39) probably null Het
Ctsl T C 13: 64,511,916 (GRCm39) probably null Het
Cul1 T A 6: 47,494,068 (GRCm39) D460E probably damaging Het
Dnttip2 T A 3: 122,069,870 (GRCm39) S362T probably damaging Het
Fbxw16 T A 9: 109,267,280 (GRCm39) D317V probably damaging Het
Fbxw9 T A 8: 85,788,839 (GRCm39) N196K possibly damaging Het
Hhatl T C 9: 121,618,137 (GRCm39) D206G probably damaging Het
Hrnr A T 3: 93,239,192 (GRCm39) Q3143H unknown Het
Ighv1-62-1 T C 12: 115,350,529 (GRCm39) Y46C probably damaging Het
Krtap16-3 A T 16: 88,759,540 (GRCm39) Y58N unknown Het
Mef2c A G 13: 83,810,716 (GRCm39) K384R probably damaging Het
Nalcn A G 14: 123,702,084 (GRCm39) Y476H possibly damaging Het
Oxgr1 A T 14: 120,259,669 (GRCm39) N179K probably damaging Het
Polk G A 13: 96,633,138 (GRCm39) Q302* probably null Het
Rab3gap1 T A 1: 127,858,512 (GRCm39) S540R probably benign Het
Samd5 A T 10: 9,504,808 (GRCm39) probably null Het
Sema6d GTGATAC G 2: 124,496,762 (GRCm39) probably benign Het
Slc1a6 C A 10: 78,623,646 (GRCm39) A15D probably benign Het
Slc8a1 A G 17: 81,956,883 (GRCm39) C52R probably damaging Het
Sod2 T A 17: 13,227,252 (GRCm39) Y69N possibly damaging Het
Tank T C 2: 61,474,768 (GRCm39) probably null Het
Tbc1d23 A T 16: 57,034,580 (GRCm39) I73N probably benign Het
Tnf A C 17: 35,420,800 (GRCm39) M6R possibly damaging Het
Trmt2a C T 16: 18,068,341 (GRCm39) A16V possibly damaging Het
Ttn A G 2: 76,556,055 (GRCm39) Y21990H probably damaging Het
Uaca C T 9: 60,779,306 (GRCm39) S1231L probably benign Het
Ubr1 A G 2: 120,754,611 (GRCm39) probably null Het
Unc13b A G 4: 43,255,562 (GRCm39) D3849G probably damaging Het
Vmn2r75 T A 7: 85,797,644 (GRCm39) D723V probably damaging Het
Wnt2 C A 6: 18,028,091 (GRCm39) V48L possibly damaging Het
Other mutations in Grap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0833:Grap UTSW 11 61,551,065 (GRCm39) missense possibly damaging 0.73
R0836:Grap UTSW 11 61,551,065 (GRCm39) missense possibly damaging 0.73
R1103:Grap UTSW 11 61,562,544 (GRCm39) missense probably benign 0.01
R1479:Grap UTSW 11 61,551,124 (GRCm39) missense probably benign 0.26
R1869:Grap UTSW 11 61,555,015 (GRCm39) missense possibly damaging 0.94
R3843:Grap UTSW 11 61,551,151 (GRCm39) splice site probably null
R3903:Grap UTSW 11 61,551,151 (GRCm39) splice site probably null
R4939:Grap UTSW 11 61,551,124 (GRCm39) missense probably damaging 1.00
R8733:Grap UTSW 11 61,562,517 (GRCm39) missense possibly damaging 0.79
R9343:Grap UTSW 11 61,562,551 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GAAGGTGTAGATGTCCACCTGC -3'
(R):5'- TCTAGCCTATCCAAGTCCCAG -3'

Sequencing Primer
(F):5'- GTAGATGTCCACCTGCCAGTATG -3'
(R):5'- AGTCAGCCAGTGCCCATC -3'
Posted On 2018-07-23