Mutagenetix > Incidental Mutation

Incidental Mutation 'R6671:Otof'

527132

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

044791-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6671 (G1)

Quality Score

166.009

Status

Validated

Chromosome

Chromosomal Location

30524406-30619276 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30576877 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 125 (V125A)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074171
AA Change: V125A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: V125A

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114747
AA Change: V125A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: V125A

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430401F13Rik	T	C	6: 131,528,313 (GRCm39)		probably null	Het
Abce1	A	G	8: 80,415,806 (GRCm39)	V404A	probably benign	Het
Cpd	T	A	11: 76,686,359 (GRCm39)	I990F	probably damaging	Het
Ddhd1	CA	C	14: 45,894,689 (GRCm39)		probably null	Het
Dnajb6	A	G	5: 29,953,418 (GRCm39)	E17G	probably damaging	Het
Fastk	T	C	5: 24,646,607 (GRCm39)	D308G	probably damaging	Het
Fkbp14	A	G	6: 54,556,662 (GRCm39)	Y69H	probably damaging	Het
Gldn	T	C	9: 54,245,691 (GRCm39)	L414P	probably damaging	Het
Glmn	T	A	5: 107,697,280 (GRCm39)	M487L	probably benign	Het
Gm3404	C	A	5: 146,464,487 (GRCm39)	R163S	probably benign	Het
Gm5591	T	G	7: 38,219,523 (GRCm39)	D450A	possibly damaging	Het
Gucy1b1	T	C	3: 81,941,715 (GRCm39)	T575A	probably benign	Het
Hydin	T	A	8: 111,327,950 (GRCm39)	V4819D	probably damaging	Het
Ikbip	A	G	10: 90,932,469 (GRCm39)		probably null	Het
Mertk	G	T	2: 128,593,943 (GRCm39)		probably null	Het
Mfsd1	T	C	3: 67,492,995 (GRCm39)	V93A	possibly damaging	Het
Myh11	A	T	16: 14,044,480 (GRCm39)	M641K	possibly damaging	Het
Myo3a	A	T	2: 22,299,333 (GRCm39)	N269Y	probably damaging	Het
Nisch	A	T	14: 30,926,420 (GRCm39)		probably benign	Het
Pla2g4a	A	G	1: 149,763,382 (GRCm39)	I93T	probably benign	Het
Prrc2c	A	G	1: 162,525,154 (GRCm39)	I484T	probably damaging	Het
Qrich1	T	A	9: 108,410,985 (GRCm39)	I170N	probably benign	Het
Rb1	A	T	14: 73,434,706 (GRCm39)	M904K	probably damaging	Het
Rgs11	A	T	17: 26,427,272 (GRCm39)	K399M	probably damaging	Het
Tmprss13	C	T	9: 45,254,529 (GRCm39)	T432M	probably damaging	Het
Tpp1	C	T	7: 105,398,814 (GRCm39)	R205H	probably benign	Het
Vps53	A	G	11: 76,025,332 (GRCm39)	Y171H	probably damaging	Het
Zbtb8b	C	T	4: 129,321,577 (GRCm39)	R395Q	probably damaging	Het
Zfp81	A	T	17: 33,554,413 (GRCm39)	C134S	probably benign	Het
Zranb1	A	G	7: 132,573,042 (GRCm39)	D403G	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30,533,248 (GRCm39)	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30,532,967 (GRCm39)	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30,556,666 (GRCm39)	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30,543,097 (GRCm39)	critical splice donor site	probably null
IGL01019:Otof	APN	5	30,562,560 (GRCm39)	missense	probably benign	0.01
IGL01025:Otof	APN	5	30,541,597 (GRCm39)	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30,533,617 (GRCm39)	critical splice donor site	probably null
IGL01110:Otof	APN	5	30,619,069 (GRCm39)	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30,538,879 (GRCm39)	missense	probably benign	0.00
IGL01285:Otof	APN	5	30,562,527 (GRCm39)	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30,598,723 (GRCm39)	missense	probably benign	0.00
IGL01337:Otof	APN	5	30,576,856 (GRCm39)	missense	probably benign	0.17
IGL01337:Otof	APN	5	30,563,121 (GRCm39)	missense	possibly damaging	0.93
IGL01834:Otof	APN	5	30,556,564 (GRCm39)	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30,536,598 (GRCm39)	splice site	probably benign
IGL01969:Otof	APN	5	30,539,827 (GRCm39)	splice site	probably benign
IGL02075:Otof	APN	5	30,528,070 (GRCm39)	missense	probably benign	0.23
IGL02077:Otof	APN	5	30,556,579 (GRCm39)	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30,531,336 (GRCm39)	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30,528,128 (GRCm39)	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30,534,026 (GRCm39)	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30,531,426 (GRCm39)	missense	probably benign	0.08
IGL02864:Otof	APN	5	30,543,685 (GRCm39)	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30,562,520 (GRCm39)	splice site	probably null
R0285:Otof	UTSW	5	30,536,877 (GRCm39)	critical splice donor site	probably null
R0421:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30,529,225 (GRCm39)	splice site	probably benign
R0599:Otof	UTSW	5	30,528,049 (GRCm39)	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30,539,705 (GRCm39)	missense	probably benign	0.01
R0715:Otof	UTSW	5	30,552,041 (GRCm39)	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30,528,087 (GRCm39)	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30,529,256 (GRCm39)	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30,536,039 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1469:Otof	UTSW	5	30,537,571 (GRCm39)	missense	probably benign	0.00
R1474:Otof	UTSW	5	30,536,876 (GRCm39)	critical splice donor site	probably null
R1524:Otof	UTSW	5	30,536,900 (GRCm39)	missense	probably benign	0.03
R1563:Otof	UTSW	5	30,528,349 (GRCm39)	missense	probably benign	0.00
R1732:Otof	UTSW	5	30,543,815 (GRCm39)	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30,536,054 (GRCm39)	missense	probably benign	0.00
R1845:Otof	UTSW	5	30,529,067 (GRCm39)	nonsense	probably null
R1925:Otof	UTSW	5	30,551,532 (GRCm39)	missense	probably benign	0.37
R1938:Otof	UTSW	5	30,533,713 (GRCm39)	missense	probably benign	0.00
R1968:Otof	UTSW	5	30,545,998 (GRCm39)	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30,578,381 (GRCm39)	missense	probably benign	0.01
R1999:Otof	UTSW	5	30,546,116 (GRCm39)	missense	probably benign	0.19
R2027:Otof	UTSW	5	30,578,358 (GRCm39)	missense	probably benign	0.08
R2138:Otof	UTSW	5	30,619,114 (GRCm39)	missense	probably benign	0.01
R2173:Otof	UTSW	5	30,543,718 (GRCm39)	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30,527,551 (GRCm39)	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30,540,184 (GRCm39)	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30,539,145 (GRCm39)	missense	probably benign	0.03
R3442:Otof	UTSW	5	30,529,033 (GRCm39)	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30,542,610 (GRCm39)	missense	probably benign
R3715:Otof	UTSW	5	30,534,215 (GRCm39)	nonsense	probably null
R3806:Otof	UTSW	5	30,543,843 (GRCm39)	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30,528,056 (GRCm39)	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30,556,635 (GRCm39)	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30,576,850 (GRCm39)	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30,539,762 (GRCm39)	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30,542,508 (GRCm39)	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30,532,344 (GRCm39)	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30,540,914 (GRCm39)	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30,578,318 (GRCm39)	critical splice donor site	probably null
R4773:Otof	UTSW	5	30,552,026 (GRCm39)	missense	probably benign	0.05
R4839:Otof	UTSW	5	30,576,748 (GRCm39)	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30,536,005 (GRCm39)	critical splice donor site	probably null
R4961:Otof	UTSW	5	30,540,837 (GRCm39)	intron	probably benign
R4991:Otof	UTSW	5	30,551,525 (GRCm39)	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30,540,238 (GRCm39)	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30,541,783 (GRCm39)	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30,527,483 (GRCm39)	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30,534,064 (GRCm39)	missense	probably benign	0.01
R5365:Otof	UTSW	5	30,539,144 (GRCm39)	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30,532,323 (GRCm39)	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30,529,244 (GRCm39)	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30,571,888 (GRCm39)	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30,529,279 (GRCm39)	missense	possibly damaging	0.94
R6701:Otof	UTSW	5	30,528,141 (GRCm39)	nonsense	probably null
R6792:Otof	UTSW	5	30,532,978 (GRCm39)	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30,545,583 (GRCm39)	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30,528,987 (GRCm39)	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30,538,882 (GRCm39)	missense	probably benign	0.32
R7060:Otof	UTSW	5	30,545,700 (GRCm39)	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30,528,912 (GRCm39)	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30,532,964 (GRCm39)	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30,540,878 (GRCm39)	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30,545,614 (GRCm39)	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30,527,614 (GRCm39)	missense	probably benign	0.45
R7397:Otof	UTSW	5	30,533,051 (GRCm39)	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30,542,532 (GRCm39)	missense	probably benign	0.04
R7428:Otof	UTSW	5	30,547,169 (GRCm39)	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30,552,005 (GRCm39)	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30,528,364 (GRCm39)	missense	probably benign	0.00
R7714:Otof	UTSW	5	30,527,597 (GRCm39)	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30,537,954 (GRCm39)	missense	probably benign	0.10
R8032:Otof	UTSW	5	30,619,142 (GRCm39)	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30,546,079 (GRCm39)	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8159:Otof	UTSW	5	30,537,538 (GRCm39)	missense	probably benign	0.37
R8441:Otof	UTSW	5	30,538,200 (GRCm39)	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30,545,968 (GRCm39)	nonsense	probably null
R8813:Otof	UTSW	5	30,540,242 (GRCm39)	missense	probably benign	0.02
R8835:Otof	UTSW	5	30,528,264 (GRCm39)	missense	probably benign	0.44
R8852:Otof	UTSW	5	30,529,044 (GRCm39)	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30,578,325 (GRCm39)	missense	probably benign	0.08
R9029:Otof	UTSW	5	30,527,419 (GRCm39)	critical splice donor site	probably null
R9031:Otof	UTSW	5	30,537,532 (GRCm39)	missense	probably benign
R9061:Otof	UTSW	5	30,546,001 (GRCm39)	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30,539,696 (GRCm39)	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30,536,462 (GRCm39)	missense	probably benign	0.04
R9188:Otof	UTSW	5	30,534,095 (GRCm39)	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30,542,469 (GRCm39)	missense	probably benign
R9280:Otof	UTSW	5	30,528,894 (GRCm39)	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30,532,976 (GRCm39)	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30,540,863 (GRCm39)	critical splice donor site	probably null
R9407:Otof	UTSW	5	30,538,265 (GRCm39)	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30,539,708 (GRCm39)	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30,584,895 (GRCm39)	missense	probably benign	0.22
R9748:Otof	UTSW	5	30,540,998 (GRCm39)	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30,536,576 (GRCm39)	missense	probably benign
Z1176:Otof	UTSW	5	30,528,930 (GRCm39)	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30,541,002 (GRCm39)	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30,533,641 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGCCTTTTGAGAGCAGTG -3'
(R):5'- CAGAATCAGGGTCTCACTGAGC -3'

Sequencing Primer
(F):5'- TGGGCAAGAAGAGACGGCC -3'
(R):5'- TCTCACTGAGCCAGCTGAC -3'

Posted On

2018-07-23